Clone FMO10014 Report

Search the DGRC for FMO10014

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:14
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG6766-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10014.5prime Sequence

1134 bp (1032 high quality bases) assembled on 2010-10-30

> FMO10014.5prime
CAGTCGACATGGGCAAGTCCTACGTGATAATTGCGAGAATAGCATTGCTG
CTGAATTTAATAATTGCAGCGGTTTCCCACGAAGCCAAAGATTTTGACGA
TTCAATTTTGTATAAAATTGATTTCGAAGTGCCGGATTTAGATGTGCAGC
CAAGCTTGGGCAATCAGCTGCGAACATTCTACACGCCGGATAAGGAGAAG
TACGACTGCCTGATTCCCACTTTGGAACACCAAAAAGAGGAGGAAAAGTC
CGACAAGCCAGAGTTGTCTCCAATTACTCTGCTGCAGCCCATTTTCTCCG
CCCTGACTTGCACGTACCGCATCGAGGCCTACTGGTCGTACGAAATCTGC
CATGGCCACCATGTGCGTCAGTATCACGAGGAGCGCGAAGGAAAGAACGT
CAAGTTCCAGGAGTACTACCTGGGCAAATGGACCGATGAAAAGATGGAAA
TACTGACAAAAGCCTGGCAAGCAGACATCAAGGCGGGCGTTAAGCCGAAA
TACAAAAGCCTGAAGATCGACAACACTCGGTATCCATACTTTGAGATGGA
ATACAGCGATGGCACTATGTGCGACATAATTAACGCTCCTCGCACCACAA
TGGTGCGTTATGTGTGCTATCCCCATGGTAAGAACGATATCTACTCCTTC
AAGGAGACATCCTCGTGCAATTATGAGGCCATTATACTTTCCTCGGCGCT
GTGCCCAATTCGCGCCCTTCATGCCGAAGAGACCAAGGAACTATCCATAC
AATGTTTCAACTCCGAATCGAAACCGCACAGACCGCTGAGCATGCTGCGG
TCGGAGCTAAAGGAATGGGTTGAATCCGAGGCGGATCTGCTGGGTTTCAA
GGAAAAGGCTACGGAAAATCTGTGGCCCAAGACGGATGGCGATTTGGTCA
CCCTTAACTATGGCGGTGATATGGAAAAGTCCTGCTCGAGCATTTCAGAA
TGGTGACCTGAAGGTAGACGAGACTTTCAGCAGCTCCTGCTGTCTATAGC
AGCTCTGAAACTGGACACCCATCACTGATCTGACGCCCTTATACTTTAAT
ATCGGCAGACTGCCTAACTGGGGCATGCTTGTTGAAGTACAGATTCTCGC
TATGCCGACTGTGCGTCCAGTCCACAAGAATAGA

FMO10014.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:10
Subject Length Description Subject Range Query Range Score Percent Strand
CG6766-RA 1882 CG6766-RA 109..1244 9..1127 5055 97.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:08
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 12039424..12040202 1038..268 3585 98.8 Minus
2L 23513712 2L 12040438..12040581 152..9 720 100 Minus
2L 23513712 2L 12040265..12040379 267..153 575 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:11:09 has no hits.

FMO10014.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:28 Download gff for FMO10014.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6766-RA 95..1191 1..1082 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:15 Download gff for FMO10014.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6766-RA 102..1198 1..1082 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:22 Download gff for FMO10014.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6766-RA 102..1198 1..1082 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:22 Download gff for FMO10014.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 12040438..12040588 1..152 97   Minus
2L 12040265..12040379 153..267 100 <- Minus
2L 12039384..12040202 268..1073 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:15 Download gff for FMO10014.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 12040438..12040588 1..152 97   Minus
arm_2L 12040265..12040379 153..267 100 <- Minus
arm_2L 12039384..12040202 268..1073 97 <- Minus