Clone FMO10016 Report

Search the DGRC for FMO10016

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:16
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG5116-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10016.5prime Sequence

1153 bp (1050 high quality bases) assembled on 2010-10-30

> FMO10016.5prime
CAGTCGACATGTCTGCTCTACGAATATTGGCCCGATTTGTCAGCACTAGG
ACTCTGCGAATTCGTCCGATTCTGGAGATTCCCGCACGCTGCAAGTACAC
CCAACATCAAGGAGTTAAGGGCATTCGGAACAGGAAGAGCTTCTTCGAAG
CCCAAATTCAGGCAGGTCAACAAGGTGAGGAGGATGCGGACTTAGAGCGG
ACAGCCAATAGCGATCTGGCGGATATGCGGTTCTTGGATGATCGAGCCTA
CGACGAGGTGGCTGGAGGAGCCATGAGAATCACACGTGACATAGCCAGCT
CTCAGCAGGTGCTCATCCTCCAACCGTATGTAAAATGGGCAGCCAAACGA
CAGAACGCACCCGTCGATGTTCGGCCCGAGGATCAACTCGCGGAGGCCAC
AGCGCTGATCCACTCCCTGCCCAATTGGCAGGTGGCCAGGGCATTAAAGG
TTCCCCTCGAAAGCCTCGAAAAGAAGACGCTTTTCGGCAGCGGCAAGCTG
GTGGAACTCAAGGAACTGGTCGCCGAATTGCGGCAGGAACGGCATCTAAC
TTGCCTGTTTGTCAGCAAGGGGACACTATCATTCGCCCAAAAACGTTTCC
TGGAGGCGGAGTTTCGCCTGCCAGTAATGGATCGCTATTCCGTTGTTATA
CAGATACTAAGACTGCATGCCACCAGCGCCGAAGCAAAACTGCAGGTAGC
CATGGCTGAACTTCCTTACATTTGGGCGCAGGCTAAGGATGCCAGTGTTA
CGCAGACGCGTCGTCAGGGCTACGCCTTGACCGATCTGCAGAAGGAGATT
CTGCGAACCAGGGAGCGAAAGTTGCGAGCGGAATTAGATCGTGTCCGGCG
ACAGAGGCAGTTGCTTCGCCAGAAAAGAAAACAGCAAAATTATCCCATCG
TTGCAGTGGTGGGTTACACAATGCTGGCAGACTTCCTTGATCAGGCACTC
ACAGTCGAGGATGCCACTGCAGCCCAGGAATCAGTGTTCGCAACGCTTGA
TGTGACTGCTCATGCTGGTTGTTGCCATGCATCTGGAGGTGATCTATTAT
GACCGGGTGGGCTTTATGTCGATCTGCAACCGGAACTGTTTTGAATGCTC
GGGTACTTGGAGGATGCCATGCGTGCCGAGTATAATGCAGATCCAGAATA
CTT

FMO10016.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:14
Subject Length Description Subject Range Query Range Score Percent Strand
CG42488-RB 2158 CG42488-RB 409..1532 8..1122 5160 98 Plus
CG5116-RB 2158 CG5116-RB 409..1532 8..1122 5160 98 Plus
CG5116-RA 2380 CG5116-RA 257..1380 8..1122 5160 98 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:11
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 25483851..25484304 244..697 2270 100 Plus
3R 32079331 3R 25484359..25484762 694..1091 1505 96 Plus
3R 32079331 3R 25483561..25483797 8..244 1185 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:11:13 has no hits.

FMO10016.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:28 Download gff for FMO10016.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5116-RA 247..1390 1..1136 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:17 Download gff for FMO10016.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5116-RA 250..1393 1..1136 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:23 Download gff for FMO10016.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5116-RA 250..1393 1..1136 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:23 Download gff for FMO10016.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 25484361..25484804 696..1132 94   Plus
3R 25483852..25484302 245..695 100 -> Plus
3R 25483554..25483797 1..244 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:17 Download gff for FMO10016.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 21310083..21310526 696..1132 94   Plus
arm_3R 21309574..21310024 245..695 100 -> Plus
arm_3R 21309276..21309519 1..244 98 -> Plus