Clone FMO10018 Report

Search the DGRC for FMO10018

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:18
Vector:pMK33-CFH-BD
Associated Gene/TranscriptDp-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10018.5prime Sequence

1121 bp (1027 high quality bases) assembled on 2010-10-30

> FMO10018.5prime
CAGTCGACATGTGTATATCGGAAACTAAGGAACCTCCGCATCTTCCAATT
TCCAATTCTGCAGGACAAATATCCAAAATGCTGAAGCCGGCCCAGAACAA
GTCCGAAATGGAGGGAGGTAAGCCCGTGGCGGTGGTCTACGCCACCGGCT
CATCCGCGCGCAACAGCGGAAGTGCTAGCGGCATCGGCAACGTGGGACGC
ATGGGCGCCTTTAGTCAGATGGGCAGTCAAGGGCAGTTTATACGACTGCA
GGACAACGGACTGTCCATTCCAAAAACAGAAGCAGGTACCACCTACACCA
CCGTTTCGGCGCAAAAGACTTCGGGTGCTGGCAGTGGTCATTACGACTTG
CCCTTGAAGGGAGATCGCTATGTGAAGTTTACACCAAATCCCATAAAAAT
GAAATCAAAACTCCATGCCATTCAGAGCAACTCGTTGCACTCCATGTCGG
CCTCCTCATCGTCCGTTCAAAGGAAACGCAAGCCGGACAAGGCAGGCAAA
GGTTTGCGCCATTTCTCGATGAAGGTATGCGAAAAGGTGGAGGAGAAGGG
CAAGACCACCTACAATGAGGTGGCCGACGACCTGGTCAGCGAGGAGATGA
AGAACAATGCGTACGACAACAACTGTGATCAAAAGAATATCCGACGTCGT
GTCTACGATGCGCTCAACGTACTGATGGCAATCAATGTTATTTCCAAGGA
CAAGAAGGAGATTCGCTGGATAGGACTGCCCGCAAATTCGACAGAGACAT
TTCTGGCCCTGGAAGAGGAAAACTGTCAGCGCCGCGAGCGAATAAAACAG
AAAAACGAAATGTTGCGCGAAATGATCATGCAGCATGTGGCGTTCAAGGG
ATTGGTCGAGCGGAACAAGCGAAACGAGAGCCAAGGCGTGGTGCCTTCCC
CGAATGCCTCGATCCAGCTACCGTTCATCATCGTGAACACCGCACAAGTC
CACGAAAATCACTGCAGTGTGACCAACGACAAGTCCGAATACTATTCAAG
TTCGACAAAACTCGAAATGCACGATGGACATGTAGGGTGCTCCAGCGTAG
GGGATTCCTATGGGACTGGGATAAAGGGCGAAAGGCCGCGAGAACATTGA
ACGATTCAAGTCTTGGTGCTC

FMO10018.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:17
Subject Length Description Subject Range Query Range Score Percent Strand
Dp-RB 2448 CG4654-RB 91..1200 9..1116 5160 98.1 Plus
Dp-RA 2526 CG4654-RA 680..1735 63..1116 4890 98 Plus
Dp-RC 1913 CG4654-RC 69..1122 62..1116 4840 97.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:15
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 13226002..13226335 413..746 1670 100 Plus
2R 25286936 2R 13226402..13226641 745..984 1105 99.2 Plus
2R 25286936 2R 13225412..13225625 9..222 1070 100 Plus
2R 25286936 2R 13225807..13225938 281..412 660 100 Plus
2R 25286936 2R 13225690..13225751 221..282 310 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:11:16 has no hits.

FMO10018.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:29 Download gff for FMO10018.5prime
Subject Subject Range Query Range Percent Splice Strand
Dp-RB 83..1203 1..1121 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:19 Download gff for FMO10018.5prime
Subject Subject Range Query Range Percent Splice Strand
Dp-RB 85..1205 1..1121 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:25 Download gff for FMO10018.5prime
Subject Subject Range Query Range Percent Splice Strand
Dp-RB 85..1205 1..1121 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:25 Download gff for FMO10018.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 13226404..13226639 747..982 99 -> Plus
2R 13226002..13226335 413..746 100 -> Plus
2R 13225809..13225938 283..412 100 -> Plus
2R 13225691..13225751 222..282 100 -> Plus
2R 13225406..13225624 1..221 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:19 Download gff for FMO10018.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 9113909..9114144 747..982 99 -> Plus
arm_2R 9113507..9113840 413..746 100 -> Plus
arm_2R 9113314..9113443 283..412 100 -> Plus
arm_2R 9113196..9113256 222..282 100 -> Plus
arm_2R 9112911..9113129 1..221 98 -> Plus