Clone FMO10019 Report

Search the DGRC for FMO10019

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:19
Vector:pMK33-CFH-BD
Associated Gene/TranscriptSytalpha-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10019.5prime Sequence

1156 bp (1025 high quality bases) assembled on 2010-10-30

> FMO10019.5prime
CAGTCGACATGACAACACATTCACTCTCAGCCGGAGAAATGGACATTGTC
ATACGTGAGGAGGACATTTCTTTGGCCCAAATTGGCGTCTATGCCTCTGT
GTCCTTTCTCGTTGTTTCTGCAGTTGGGGCAGCGCTGTATACCACCTGCT
CAAAACGCTATCGCCTGAACTGGTTCGAACAAAATCTCCTGGAGTCCGCC
AACGAAAAGGATGAAGATCAGCAAAGGGAGGCTTTGGTTGCCGGTGCCGT
GGGCTACAATGTGGACAACGTGAACGAGGTACCGCGTGGGAAATACAGCA
GCGGAAATGCCGGTAACCTCAGCCCCACCTCTCTGAAAAGCGAGGACAAT
GACCCGGCCTTTTGGGTGCCGGCTTCAGTCACCTCCACGGCAGCCATCCA
GCAACAAGTGTCCAATACCACCGAGGAGTCCGCACCGCCAACATCACCCA
CCGGGAGCCTGAAGTCAAACACCTTGTCCTACTGTTCCACCACCTCCGTG
CCAATCGCGAGATCTGATAAGCATGTGGTCCTTGCTATGCATCCGAGCCG
TCCCAGAGTTTCCTCTATGAACGCCAAGCTGGATCACACCAAAATCGACA
TGACCTTGTATAGAAGTCATTCTCAGCCGAAGACTATCAATCCAGTTTCA
CTCAACGAAGTTCGGGGTAATTTGCATGTGAGTCTTGGCTACGATCCAGT
TGGAGGATTGCTAAATGTTCGACTCCTGGAGGCCCAGAATCTGCAACCGA
GGCAATTTAGTGGAACTGCCGACCCATATGCCAAAGTCCGCTTGCTGCCG
GATAAAAAGAACTTTTGGCAGACGCGTATACACAAGAGGACCCTGAATCC
AGTTTTCGACGAGCAGTTTGTTTTTGAGGTAACAGCCGGAGTAATTGACA
AGCGTACTGTGGAAATTTTACTATACGACTTTGATGCTTATTCCCGGCAC
GTTTGCATCGGAGGAAGTAGCTACATTTGGGCCAACTTGAACTCAGCGAG
CAATTGAAGTTGTGGACTCCCTCTTAGTTCTGCCTCGCCAAAATATGAAA
GGTGGAATTTGGGCGATATAAATGTGTTCCCTAGCCTATTTGCCATCAGC
GGAACGTTGATTGTCGCCCTTATCAAGCACGACTGCGATGGCACACATTG
CCGGAA

FMO10019.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:21
Subject Length Description Subject Range Query Range Score Percent Strand
Sytalpha-RB 1931 CG5559-RB 65..1189 9..1132 5280 98.4 Plus
Sytalpha-RC 2189 CG5559-RC 333..1447 19..1132 5230 98.4 Plus
Sytalpha-RA 2037 CG5559-RA 181..1295 19..1132 5230 98.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:19
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 17601451..17601843 225..617 1965 100 Plus
2L 23513712 2L 17601912..17602146 618..852 1175 100 Plus
2L 23513712 2L 17600941..17601149 19..227 1045 100 Plus
2L 23513712 2L 17602203..17602480 850..1127 870 90.7 Plus
Blast to na_te.dros performed on 2014-11-26 15:11:20 has no hits.

FMO10019.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:30 Download gff for FMO10019.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5559-RA 174..1295 12..1132 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:20 Download gff for FMO10019.5prime
Subject Subject Range Query Range Percent Splice Strand
Sytalpha-RB 65..1189 9..1132 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:27 Download gff for FMO10019.5prime
Subject Subject Range Query Range Percent Splice Strand
Sytalpha-RB 65..1189 9..1132 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:27 Download gff for FMO10019.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 17602206..17602498 853..1139 92 -> Plus
2L 17601912..17602146 618..852 100 -> Plus
2L 17601453..17601843 227..617 100 -> Plus
2L 17600938..17601148 16..226 99 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:20 Download gff for FMO10019.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 17602206..17602498 853..1139 92 -> Plus
arm_2L 17601912..17602146 618..852 100 -> Plus
arm_2L 17601453..17601843 227..617 100 -> Plus
arm_2L 17600938..17601148 16..226 99 -> Plus