Clone FMO10021 Report

Search the DGRC for FMO10021

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:21
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCyp313a1-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10021.5prime Sequence

1150 bp (1050 high quality bases) assembled on 2010-10-30

> FMO10021.5prime
CAGTCGACATGTTAACTATCAATTTGTTACTGGCGGTCGGAGCTCTTTTT
TGGATTTATTTCTTATGGAGTCGCCGAAGGTTATATTTCCTGATGCTAAA
GATTCCCGGACCCATAGGACTACCCATTTTGGGTAGCTCCCTGGAAAATA
TCATCACCTATAAACGTAAACTAAGCTTTCGAACAAAGTATTTGAATAAG
TACGGCTCGACTATTTTAACGTGGATGGGTCCGGTGCCATTTATAGTGAC
ACGAGATCCGAAAGTCGTTGAGGATATCTTTTCGTCTCCTGATTGCCACA
ACAAGAGCCAGCATATTGTGAATGCCATAACTTCTTGTATGGGAAATGGA
TTGCTGGGAAAACAAGATCCTCATTGGCTTGATCGCCGCAAGCACTTTAA
CCCATCGTTTAAACAGGATCTTTTGCTTAGCTTCTTTCACATTTTCGATG
CCGAGACGAAAGTCCTGATGAATTTACTAGATACTTATGTCGACAAAGGC
GAAATAGATGTGGTTCCAGAGATGCTTAGATGGTCTTTTAAAATAGCCGC
CCAAACCACAATGGGTTCTGAAGTTAAACATGATGAGCACTTCAAAAATG
GCAGCCTCGTGGAAAGCTTCGAATCGCTCATATCTCATTCGACTCTCAAT
ATATTGATGCCCTTGGTTCAAAACAGGATGATTTCAAAAATATGCGGTTA
TGATAAGTTACGAGCTGACAACTTTTCTAGAATTCAAAAAATGTTGGACA
ACGTGGTTAATAAAAAAGTCAATCCATTGCCAAAGACTGATTCAGATCCC
GAATCGAACATTGTGATCAATAGGGCAATGGAACTGTACCGTAAAGGCGA
TATCACCTATATGGATGTGAAGAGCGAATGTTGTATAATGATTGCCGCCG
GCTATGATACATCAGCTCTAACAGTTTATCACGCACTCTTCCTACTGGCC
AATCATCCCGAGCACCAGGAAGCGGTCTTTGAGAGCTAAATGGTGTCTTC
CCAGAATGCCGGACACCTTTGGATAACATACCCAGAAAATGCAGAACCTG
GACTACTTGGAGCGCGGTGATAAGGAGACACTACGCCCTGATACTGCTAT
CATAACGCAGGAACCAAGAATGAGTTCGTCTCCTCGAATGGATTTCATTC

FMO10021.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:25
Subject Length Description Subject Range Query Range Score Percent Strand
Cyp313a1-RA 1623 CG3360-RA 55..1198 9..1146 5260 98.1 Plus
Cyp313a3-RA 1777 CG10093-RA 196..446 47..297 190 72.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:23
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 14522173..14522506 753..1087 1380 96.1 Plus
3R 32079331 3R 14521338..14521538 166..366 1005 100 Plus
3R 32079331 3R 14521601..14521788 365..552 940 100 Plus
3R 32079331 3R 14521103..14521264 9..170 810 100 Plus
3R 32079331 3R 14521996..14522131 626..761 650 98.5 Plus
3R 32079331 3R 14521850..14521923 553..626 370 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:11:24 has no hits.

FMO10021.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:30 Download gff for FMO10021.5prime
Subject Subject Range Query Range Percent Splice Strand
Cyp313a1-RA 23..1132 1..1106 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:23 Download gff for FMO10021.5prime
Subject Subject Range Query Range Percent Splice Strand
Cyp313a1-RA 45..1154 1..1106 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:29 Download gff for FMO10021.5prime
Subject Subject Range Query Range Percent Splice Strand
Cyp313a1-RA 45..1154 1..1106 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:29 Download gff for FMO10021.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 14522173..14522528 753..1106 96   Plus
3R 14521996..14522122 626..752 100 -> Plus
3R 14521850..14521922 553..625 100 -> Plus
3R 14521603..14521788 367..552 100 -> Plus
3R 14521338..14521538 166..366 100 -> Plus
3R 14521093..14521259 1..165 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:23 Download gff for FMO10021.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 10347895..10348250 753..1106 96   Plus
arm_3R 10347718..10347844 626..752 100 -> Plus
arm_3R 10347572..10347644 553..625 100 -> Plus
arm_3R 10347325..10347510 367..552 100 -> Plus
arm_3R 10347060..10347260 166..366 100 -> Plus
arm_3R 10346815..10346981 1..165 97 -> Plus