Clone FMO10022 Report

Search the DGRC for FMO10022

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:22
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG10866-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10022.5prime Sequence

698 bp (698 high quality bases) assembled on 2010-10-30

> FMO10022.5prime
CAGTCGACATGCCCCACTGCCACACAATGGTCTATATGCGAATTGTGCTA
ACAACCTTGGTGACCATTACGTGTCTGCTGGGGGACAACTTTGTGGAGCT
GACCCAGCATCCATTGCTGAAGGCCCTGGCCGACAATGCCACCCATGCGG
CCATTGGAGCACTCACGGGAATCACGTTCGCCACACAATTCTACGAGCGC
ACCTCGCAGTTGTTCGGCTGGATATTGATTTTCACCTGCTTCGTTGTGTC
ATCGTTCATTGACTTGGACCACTTTGTGGAGGCTCGTTCCCTTTATTTGG
AGGATGCCACCAATCTGTCGAAGAGGCCCTTCCTCCACTGCTCCAGCATT
ATAGTGGTTATGCTGCTGTTCTACATGTGCACCGCCTGTTTGAACTATTT
CCGGACCAGCCTAATGCTGGGATCCCTACTCTGTGCCTTCATCACACACC
ACACCAGGGACGCCGTGCGGCGGGGCTACTGGCTGTGCCCGCTAGGTCAC
ACGGACAGGATGCCCCAGCTAGCCTACATATTGACCACCATCCTGACGCC
CCATCTGCTGGGCTGCCTGCACAACGTGTGCCGCAGCGCAACCGTGCTTA
ACTTCCTGGGGCAGTACGTCAAGCTAAGCGAGGGCCAATACCGCAGCGGC
TCCACTGCCAACTATCGCTACATGCAGGTCGCAAGCTTTCTAGACCAT

FMO10022.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:28
Subject Length Description Subject Range Query Range Score Percent Strand
CG10866-RB 1874 CG10866-RB 247..918 9..680 3360 100 Plus
CG10866-RA 1337 CG10866-RA 247..918 9..680 3360 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:26
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 3937016..3937395 680..301 1900 100 Minus
3L 28110227 3L 3937452..3937746 303..9 1475 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:11:27 has no hits.

FMO10022.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:31 Download gff for FMO10022.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10866-RA 190..870 1..681 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:25 Download gff for FMO10022.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10866-RA 190..873 1..687 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:31 Download gff for FMO10022.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10866-RA 241..924 1..687 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:31 Download gff for FMO10022.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 3937453..3937750 1..302 98   Minus
3L 3937010..3937393 303..687 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:25 Download gff for FMO10022.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 3937453..3937750 1..302 98   Minus
arm_3L 3937010..3937393 303..687 99 <- Minus