Clone FMO10024 Report

Search the DGRC for FMO10024

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:24
Vector:pMK33-CFH-BD
Associated Gene/Transcript
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10024.5prime Sequence

581 bp (581 high quality bases) assembled on 2010-10-30

> FMO10024.5prime
CAGTCGACATGGCAGGGTCCATCCGTTTCAGAATGGGTCCAATTACACTA
TTGCTTTCGATACTCTTGGTTCATAGTTGTCGAGCCGAAAAGCCGTACAG
TGTGGAGCTAAACACCTTTACGATGGACGACACCATCGAAAATCAGGAAA
ATTGGGTAGACTGGGGAACGCTGAGTATGAAAAAGGTCTCACGAAATCAA
TTTGTGGTTAGCGGAGACTTTGAATTCAAACTCAATATGGCCGATGAGCA
GAAGATTGTTCTCATGGTTTATGTCTACGATTCCAATGCCAATCAAAGGG
GTTCGATGGTAATGGCTGTTAAAAAGCCGTTCTGTCAGTTCATTAAAGAG
GATGAGGACTCGTATCCAAGCATACAAAAGGCTTCCAATTTACCGGATCA
GGATACGTGCCCATTTCCGAAAGGCAAATATACTATCGATAACTACGAAT
TGGAGACCAATTTCCTACCGGACAATGCACCCAAAGGCGACTATCTGTTG
CAGTTATCCTTGTTGGATCGTGAGGTCCCAGTAGCAGGACTTGTGGCTAC
TGTTACCCTGACTGCAAGCTTTCTAGACCAT

FMO10024.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:36
Subject Length Description Subject Range Query Range Score Percent Strand
CheA7a-RA 721 CG15033-RA 10..564 9..563 2760 99.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:34
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 7378486..7378796 253..563 1540 99.7 Plus
X 23542271 X 7378149..7378394 9..254 1230 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:11:34 has no hits.

FMO10024.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:32 Download gff for FMO10024.5prime
Subject Subject Range Query Range Percent Splice Strand
CheA7a-RA 1..534 33..567 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:30 Download gff for FMO10024.5prime
Subject Subject Range Query Range Percent Splice Strand
CheA7a-RA 1..568 2..568 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:33 Download gff for FMO10024.5prime
Subject Subject Range Query Range Percent Splice Strand
CheA7a-RA 1..568 2..568 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:33 Download gff for FMO10024.5prime
Subject Subject Range Query Range Percent Splice Strand
X 7378488..7378800 255..568 99   Plus
X 7378139..7378394 1..254 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:30 Download gff for FMO10024.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 7272521..7272833 255..568 99   Plus
arm_X 7272172..7272427 1..254 98 -> Plus