Clone FMO10026 Report

Search the DGRC for FMO10026

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:26
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG3621-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10026.5prime Sequence

335 bp (335 high quality bases) assembled on 2010-10-30

> FMO10026.5prime
CAGTCGACATGTCTGCCCTGCGCCGTGATGTGTCGCCTTTAATCCAGCGC
ATTCGGGCCTTCCTCCTGGGTCGGGAGCACAACCTGGCCCTGCGCTTCGA
GGACGGACTGGCCGATCGCACCCAGCCACAGCCGGAAATCCCTGACGGTC
CATCGCATCTACTCTCGGCCAACTACTACTGCCAGCGGGATGGACGTCGC
GAGGTTCTGCCGCCCATCGACCTGGTGGAGCAGCAGAAGCAGCTGGCGGC
AGAGGGGGAAGCGGCGAAGGCCCCGTCTTCCAAGCTGCCCACTCCCGGCA
AGGTCTATGCCTGGGATGCAAGCTTTCTAGACCAT

FMO10026.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:38
Subject Length Description Subject Range Query Range Score Percent Strand
CG3621-RB 807 CG3621-RB 118..426 9..317 1545 100 Plus
CG3621-RA 512 CG3621-RA 118..426 9..317 1545 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:37
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 2172806..2173051 72..317 1230 100 Plus
X 23542271 X 2172643..2172705 9..71 315 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:11:38 has no hits.

FMO10026.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:32 Download gff for FMO10026.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3621-RA 117..428 9..321 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:32 Download gff for FMO10026.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3621-RA 118..429 9..321 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:36 Download gff for FMO10026.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3621-RA 118..429 9..321 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:36 Download gff for FMO10026.5prime
Subject Subject Range Query Range Percent Splice Strand
X 2172806..2173054 72..321 99   Plus
X 2172643..2172705 9..71 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:32 Download gff for FMO10026.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 2066839..2067087 72..321 99   Plus
arm_X 2066676..2066738 9..71 100 -> Plus