Clone FMO10027 Report

Search the DGRC for FMO10027

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:27
Vector:pMK33-CFH-BD
Associated Gene/TranscriptRpp20-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10027.5prime Sequence

527 bp (527 high quality bases) assembled on 2010-10-30

> FMO10027.5prime
CAGTCGACATGATGGGAAGCAATTATCCCGAGCACGGGACCAAGCCGAGA
TCCGCCAAATACCACAAACAACAGAACCACCGAGTGGTGCGCAAGCAGCC
GCCGCGTCCCGCTGTTAGCGACCGCCACAACATCTACATCACCAGCAAGA
CAGACTTTAAGGCCCAGCAGCGCCGCTGCGAGGAGCTGATTAACTCCGGC
GCCCACGAGATCTTTCTGCATTGCATGGGCTTCTCCGTAACCCGCGGCCT
CAATATCGCCCTACGCCTCGTCCAGAATTCTGACGGCGCCCTTAGCTACG
CCATCAACACCTCCACCGTTCAGCTGGTGGACGAACTGCACCCGCTGTGC
GATGCCGAGGACATAACCTTCCGCCAGCGCAACAACTCGGCCCTGCACAT
CAAGATCCTCAATAACAGTCTCTTCGACATCGCCGTGCCGCAACCGTCGC
AGTCCCAGACGCAAGCCCAGTCCCTGGGCCAGTTCCGAGGCAAGGCGAAG
GCCAGGCAGGCAAGCTTTCTAGACCAT

FMO10027.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:42
Subject Length Description Subject Range Query Range Score Percent Strand
Rpp20-RB 1395 CG33931-RB 99..599 9..509 2505 100 Plus
Rpp20-RA 1244 CG33931-RA 99..599 9..509 2505 100 Plus
CG33932-RB 1395 CG33932-RB 99..599 9..509 2505 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:40
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 19744753..19745102 160..509 1750 100 Plus
X 23542271 X 19744529..19744683 9..163 775 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:11:41 has no hits.

FMO10027.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:33 Download gff for FMO10027.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpp20-RA 97..601 9..515 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:33 Download gff for FMO10027.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpp20-RA 99..603 9..515 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:38 Download gff for FMO10027.5prime
Subject Subject Range Query Range Percent Splice Strand
CG33932-RB 99..603 9..515 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:38 Download gff for FMO10027.5prime
Subject Subject Range Query Range Percent Splice Strand
X 19744761..19745106 168..515 99   Plus
X 19744529..19744685 9..167 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:33 Download gff for FMO10027.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 19638794..19639139 168..515 99   Plus
arm_X 19638562..19638718 9..167 98 -> Plus