Clone FMO10028 Report

Search the DGRC for FMO10028

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:28
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPu-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10028.5prime Sequence

845 bp (845 high quality bases) assembled on 2010-10-30

> FMO10028.5prime
CAGTCGACATGAAGCCCCAGACAAGCGAGCAAAATGGCAGTGGCCAAAAT
GGCGAGGGTGCCGCAGATGCCGTGGCCGTTGCCACGATCCCCACGGGCGA
AGCCTCCGCCGCCTCCGCCACGTCCGGCACCGATCTAACGGTCTCCAAAA
ACAGCCAGCAGCTGAAACTGGAAATGCTCAACTTGGAGCTGGCCAGCAAT
GGAAGCGGCCACGAGAAGTGCACGTTCCACCACGACCTGGAGCTGGACCA
CAAGCCGCCGACGCGAGAGGCCCTCCTTCCGGACATGGCACGCTCGTATC
GTCTACTCTTGGGCGGCCTGGGCGAGAATCCCGATCGCCAGGGACTGATC
AAGACGCCGGAGCGGGCAGCCAAGGCCATGCTGTACTTCACCAAGGGCTA
CGACCAGAGTCTCGAGGATGTTCTCAATGGCGCCGTTTTCGACGAGGATC
ATGACGAAATGGTGGTGGTCAAGGATATTGAAATGTTCTCCATGTGCGAG
CATCATCTGGTGCCCTTCTACGGCAAAGTTTCCATCGGTTATTTGCCGTG
CAACAAGATTCTCGGACTCAGTAAATTGGCACGCATTGTCGAAATATTTT
CGCGTCGCCTGCAAGTCCAGGAGCGCTTAACTAAGCAGATCGCAGTGGCC
GTGACTCAGGCCGTGCAACCCGCTGGAGTAGCAGTGGTCGTAGAGGGAGT
CCACATGTGCATGGTGATGCGTGGCGTGCAGAAGATCAACAGCAAAACTG
TTACCTCAACTATGCTGGGCGTGTTCCGAGACGATCCCAAGACCCGTGAG
GAATTCCTGAACTTAGTCAATAGCAAAGCAAGCTTTCTAGACCAT

FMO10028.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:45
Subject Length Description Subject Range Query Range Score Percent Strand
Pu-RB 1625 CG9441-RB 159..979 7..827 4105 100 Plus
Pu-RA 1793 CG9441-RA 527..1147 207..827 3105 100 Plus
Pu-RC 1744 CG9441-RC 478..1098 207..827 3105 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:43
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 21179937..21180147 207..417 1055 100 Plus
2R 25286936 2R 21175473..21175674 7..208 1010 100 Plus
2R 25286936 2R 21181419..21181585 417..583 835 100 Plus
2R 25286936 2R 21181836..21181962 701..827 635 100 Plus
2R 25286936 2R 21181644..21181761 583..700 590 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:11:44 has no hits.

FMO10028.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:34 Download gff for FMO10028.5prime
Subject Subject Range Query Range Percent Splice Strand
Pu-RB 150..977 1..827 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:34 Download gff for FMO10028.5prime
Subject Subject Range Query Range Percent Splice Strand
Pu-RB 152..979 1..827 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:40 Download gff for FMO10028.5prime
Subject Subject Range Query Range Percent Splice Strand
Pu-RB 152..979 1..827 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:40 Download gff for FMO10028.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 21181836..21181962 701..827 100   Plus
2R 21181645..21181761 584..700 100 -> Plus
2R 21181420..21181585 418..583 100 -> Plus
2R 21179938..21180147 208..417 100 -> Plus
2R 21175466..21175673 1..207 99 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:34 Download gff for FMO10028.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 17069341..17069467 701..827 100   Plus
arm_2R 17069150..17069266 584..700 100 -> Plus
arm_2R 17068925..17069090 418..583 100 -> Plus
arm_2R 17067443..17067652 208..417 100 -> Plus
arm_2R 17062971..17063178 1..207 99 -> Plus