Clone FMO10029 Report

Search the DGRC for FMO10029

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:29
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG7059-RD
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10029.5prime Sequence

812 bp (812 high quality bases) assembled on 2010-10-30

> FMO10029.5prime
CAGTCGACATGCGCGAAATTCAGGCCTCCCAATTTATGACGAAAACAAAT
CGCTTGGTGATTTTGAGGCATGGCGAAAGTGATTTCAACATTGAGAACAA
ATTCTGCGGTTGGCATGATGCGCCATTGAGTGAATTCGGCGTCCAGGAGG
CCCTGACTGTGGCGATTCCCGCGCTCGTCCAATCCGAGTTGGAATTCGAC
GTGGTCTATTCATCCGTATTGAGCAGATCTCGTCAAACGGCCGAATTGAT
ACTCTCCAAGTTGAACTGCGCCTATGTGCCCATTAAGGAGGATTGGCGGC
TGTGCGAAAGGCACTACGGAAATCTGACTGGTTGCCGGAAACGAGTGGTA
GCCGATCGCTATGGGGAGGAGCAGGTTCAGGCCTGGCGACGTGGATACGA
CTGCGTACCGCCGCCCATCGATGAGAAGAACCGCTACTTCTACACCATTT
GCAGCAATCCCATATTCGATGATGTTCCTCGCGGTGAGTTCCCCCTCGCG
GAATCCCTTCACATGTGCGTCGATCGAGTGAAACCCGTGTGGAAGGAGGT
CAGGCGGGAAGTGTTCCAAGGCACCCGGGTACTAATGTGCGTCCACGGAA
CTGTGGCCCGTGCTCTCGTCCAGCACATTGAGGGAATCTCCAACGAGGCC
ATCGAAAAGGTTAACATTCCAAATTGCGTGCCACGCGTCTATGAGTTCGA
TTTGAAAACGGGAGGCTTGGTTGGAGCTGCCATCAATCTGGGGGATCAGG
AGTATATTAGGCGGAAGACAGCCCAGGTGGCAGCCATTGGTGACGCAAGC
TTTCTAGACCAT

FMO10029.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:49
Subject Length Description Subject Range Query Range Score Percent Strand
CG7059-RD 1261 CG7059-RD 207..992 9..794 3930 100 Plus
CG7059-RC 1238 CG7059-RC 201..969 26..794 3845 100 Plus
CG7059-RA 1332 CG7059-RA 295..1063 26..794 3845 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:47
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 22391368..22391864 138..634 2485 100 Plus
3R 32079331 3R 22391919..22392080 633..794 810 100 Plus
3R 32079331 3R 22391194..22391307 26..139 570 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:11:48 has no hits.

FMO10029.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:34 Download gff for FMO10029.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7059-RD 207..992 9..794 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:36 Download gff for FMO10029.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7059-RD 207..992 9..794 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:41 Download gff for FMO10029.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7059-RD 207..992 9..794 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:41 Download gff for FMO10029.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 22391920..22392080 634..794 100   Plus
3R 22391369..22391863 139..633 100 -> Plus
3R 22391194..22391306 26..138 100 -> Plus
3R 22390186..22390202 9..25 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:36 Download gff for FMO10029.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 18217642..18217802 634..794 100   Plus
arm_3R 18217091..18217585 139..633 100 -> Plus
arm_3R 18216916..18217028 26..138 100 -> Plus
arm_3R 18215908..18215924 9..25 100 -> Plus