Clone FMO10030 Report

Search the DGRC for FMO10030

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:30
Vector:pMK33-CFH-BD
Associated Gene/Transcriptgus-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10030.5prime Sequence

1051 bp (1041 high quality bases) assembled on 2010-10-30

> FMO10030.5prime
CAGTCGACATGTATAAGGGTGGTCGGACACCTTCTATTAGGTCCAGTGAA
AGGCGTCGTCCTCAAAGTGTTTCATCTATATCCACACTATCCCCGAGAGT
TGTTTTGTCCAGATTGGAGCCGAGGGAGTTTGAACGTCTTCGACTATCCT
ACAAAATTGCAATCGACCAAAGAAGATCCAGAAGCTGCCGTGGCATGAAC
ATGGGTCAAAAAATTAGTGGCGGAGTCAAAACAGTTAGTCGCAATGATTC
ACAGTCTACATTTAAACCAATAATACCAAGAGAGTTGCAAGCTGATTTCG
TTAAACCAGCGCGAATCGATATATTACTTGATATGCCGCCAGCATCTCGA
GATCTTCAATTGAAGCATTCATGGAACTCCGAAGATCGGTCTCTTAACAT
TTTTGTAAAAGAGGACGACAAGTTGACATTTCATAGGCACCCAGTGGCTC
AAAGTACTGACTGTATTCGCGGAAAAGTCGGACTTACAAAGGGATTGCAT
ATTTGGGAAATTTATTGGCCAACAAGGCAAAGAGGAACCCACGCTGTTGT
TGGCGTATGCACTGCAGATGCACCTTTACATTCAGTTGGCTACCAAAGTT
TAGTTGGATCAACTGAACAAAGTTGGGGCTGGGACTTAGGAAGAAATAAA
TTATACCATGACTCAAAAAACTGCGCTGGAGTGACATATCCAGCAATTCT
TAAAAACGACGAAGCTTTTTTAGTTCCAGATAAGTTCTTAGTAGCGTTAG
ATATGGACGAAGGAACACTAAGCTTCATTGTTGATCAGCAGTACCTCGGT
ATTGCGTTTAGAGGACTGCGAGGGAAAAAACTATATCCAATTGTTTCGGC
GGTCTGGGGACACTGTGAAATAACAATGCGTTACATTGGTGGATTAGATC
CCGAACCCTTGCCCTAATGGATCTTTGCCGAGAACAATTCGTCAAAATTG
GTCGCACAAACTTGGAGGAGCACATTCAACAGCTTCACTTCCTTTATTAA
TGAAAACATATTTTATTGTATAAAACCGTAGAGCAAGCCTTCCTAGACCA
T

FMO10030.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:52
Subject Length Description Subject Range Query Range Score Percent Strand
gus-RM 1525 CG2944-RM 163..1191 9..1032 4970 99.2 Plus
gus-RK 1813 CG2944-RK 332..1360 9..1032 4970 99.2 Plus
gus-RJ 1730 CG2944-RJ 368..1396 9..1032 4970 99.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:50
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 5120763..5121652 900..11 4450 100 Minus
2R 25286936 2R 5117674..5117802 1025..901 370 94.6 Minus
Blast to na_te.dros performed on 2014-11-26 15:11:51 has no hits.

FMO10030.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:35 Download gff for FMO10030.5prime
Subject Subject Range Query Range Percent Splice Strand
gus-RB 81..1117 1..1036 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:37 Download gff for FMO10030.5prime
Subject Subject Range Query Range Percent Splice Strand
gus-RJ 368..1399 9..1036 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:43 Download gff for FMO10030.5prime
Subject Subject Range Query Range Percent Splice Strand
gus-RJ 368..1399 9..1036 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:43 Download gff for FMO10030.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 5120763..5121652 11..900 100   Minus
2R 5117663..5117802 901..1036 92 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:37 Download gff for FMO10030.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 1008268..1009157 11..900 100   Minus
arm_2R 1005168..1005307 901..1036 92 <- Minus