Clone FMO10031 Report

Search the DGRC for FMO10031

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:31
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG3192-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10031.5prime Sequence

551 bp (551 high quality bases) assembled on 2010-10-30

> FMO10031.5prime
CAGTCGACATGTCGGCGTTTGTGAAAACCGTGTGCTTGGCCCAAAAGCTG
TGCGCCGCCAATCCCGTCGTGGCTCGCCAGGCGATCCGCAGCATGGCTGG
CTGGAATAAGGACTACAAGCCGGGTCCGTATCCACAGACGGAGAAGGAGC
GCCTGGCGGCGGCCAAGAAGTACTATCTGTTGCCGGAGGAGTACAAACCG
TATGCGGACGATGGTCTGGGCTACGGAGATTATCCCAAATTGGGCTACGG
TCTGGGTGTGGAGGCCAAGGACTCGTACTATCCCTGGGACTATCCGGAGC
ACAAGCGCAACCAACACGAGCCCATCTCGGCGGATCATGATCTGTACAGC
GAGGATCGCTGGTCGCAGGCCGAACCGCCACGCTACAGCAATGCGTACTA
CTTTGCCTGCTTCCTGGGCGTGATGTCCGGCTGCCTGGCACTCTACTACT
GGCTGGATGACAAGAAGATGTACCGCCCCGTGGCCGCCAAGCAATATCCC
AGCCCTGGCGTCAAGCACTACACCTTCGAGAAGGCAAGCTTTCTAGACCA
T

FMO10031.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:56
Subject Length Description Subject Range Query Range Score Percent Strand
CG3192-RC 706 CG3192-RC 78..602 9..533 2625 100 Plus
CG3192-RB 805 CG3192-RB 177..701 9..533 2625 100 Plus
CG3192-RA 1321 CG3192-RA 693..1217 9..533 2625 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:54
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 6677652..6677881 323..94 1150 100 Minus
X 23542271 X 6677366..6677575 533..324 1050 100 Minus
X 23542271 X 6678000..6678084 93..9 425 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:11:55 has no hits.

FMO10031.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:35 Download gff for FMO10031.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3192-RA 688..1224 1..541 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:39 Download gff for FMO10031.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3192-RA 688..1224 1..541 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:45 Download gff for FMO10031.5prime
Subject Subject Range Query Range Percent Splice Strand
CG3192-RA 688..1224 1..541 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:45 Download gff for FMO10031.5prime
Subject Subject Range Query Range Percent Splice Strand
X 6678000..6678089 1..93 95   Minus
X 6677652..6677881 94..323 100 <- Minus
X 6677359..6677575 324..541 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:39 Download gff for FMO10031.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 6572033..6572122 1..93 95   Minus
arm_X 6571685..6571914 94..323 100 <- Minus
arm_X 6571392..6571608 324..541 98 <- Minus