Clone FMO10032 Report

Search the DGRC for FMO10032

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:32
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCp1-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10032.5prime Sequence

1140 bp (1038 high quality bases) assembled on 2010-10-30

> FMO10032.5prime
CAGTCGACATGAATCACCTTGGCGTTTTTGAAACCCGTTTTCGCCCTCGA
ACTAGGCACAAATCGCAGAGGGCACAATTGATTCCAGAACAAATCACAAT
GCGCACAGCTGTTTTGCTGCCACTTTTGGCCCTGCTGGCGGTGGCTCAGG
CCGTTTCCTTCGCCGACGTGGTCATGGAGGAATGGCATACGTTCAAGCTG
GAGCACCGCAAGAACTATCAGGATGAAACCGAGGAGCGTTTCCGCCTCAA
GATCTTCAATGAGAACAAGCACAAGATTGCCAAGCACAACCAGCGATTCG
CCGAGGGCAAGGTGAGCTTCAAACTGGCGGTCAATAAGTACGCCGATTTG
CTGCACCACGAATTCCGTCAGCTGATGAACGGCTTCAACTACACTCTGCA
CAAGCAACTGCGTGCCGCCGATGAAAGCTTCAAGGGAGTCACCTTCATCT
CGCCGGCTCATGTGACGCTGCCCAAATCTGTGGACTGGCGCACCAAGGGA
GCTGTGACCGCCGTCAAGGATCAGGGACACTGCGGCAGCTGCTGGGCCTT
CTCCAGCACAGGCGCCCTCGAGGGTCAGCATTTCCGCAAGTCCGGTGTCC
TCGTCTCGCTGTCCGAGCAGAATCTGGTCGATTGCTCCACCAAGTACGGC
AACAATGGATGCAACGGCGGTCTCATGGACAATGCCTTCCGCTATATTAA
GGATAATGGAGGCATCGATACCGAGAAGTCCTATCCCTACGAGGCCATCG
ATGACTCGTGCCACTTTAACAAGGGCACAGTCGGAGCCACCGATCGTGGA
TTCACCGATATTCCCCAGGGTGATGAGAAGAAGATGGCCGAGGCTGTGGC
CACCGTTGGTCCCGTTTCCGTCGCCATCGATGCCTCCCACGAGTCGTTCC
AGTTCTACTCGGAGGGCGTCTACAACGAGCCGCAGTGTGATGCCCAGAAT
CTGGATCACGTGTGCTGTCGTTGCTTCGCACCGACGAGTCCGGCGAGATT
ACTGGCTGTGAAAAACTCGTGGGGACCACCTGGGGGCGAACAGGCTTCAT
CAGATGCTGCGCAACAGAGAACAGTCGGCATCGCTAGCGCCCTCCAGCTA
TCCTGGTCCAAGCTTCTAGAACCATTCGTTTGGGGCCGGC

FMO10032.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:11:59
Subject Length Description Subject Range Query Range Score Percent Strand
Cp1-RC 1369 CG6692-RC 14..1119 9..1103 5130 98.4 Plus
Cp1-RA 1486 CG6692-RA 201..1236 79..1103 4780 98.3 Plus
Cp1-RD 1481 CG6692-RD 313..1231 196..1103 4195 98 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:11:57
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 13967029..13967691 412..1066 2810 97.7 Plus
2R 25286936 2R 13966753..13966969 196..412 1085 100 Plus
2R 25286936 2R 13962219..13962336 80..197 590 100 Plus
2R 25286936 2R 13961194..13961265 9..80 360 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:11:58 has no hits.

FMO10032.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:36 Download gff for FMO10032.5prime
Subject Subject Range Query Range Percent Splice Strand
Cp1-RC 7..1132 1..1113 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:41 Download gff for FMO10032.5prime
Subject Subject Range Query Range Percent Splice Strand
Cp1-RC 7..1132 1..1113 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:47 Download gff for FMO10032.5prime
Subject Subject Range Query Range Percent Splice Strand
Cp1-RC 7..1132 1..1113 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:47 Download gff for FMO10032.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 13967030..13967744 413..1113 96   Plus
2R 13966755..13966969 198..412 100 -> Plus
2R 13962220..13962336 81..197 100 -> Plus
2R 13961187..13961265 1..80 95 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:41 Download gff for FMO10032.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 9854535..9855249 413..1113 96   Plus
arm_2R 9854260..9854474 198..412 100 -> Plus
arm_2R 9849725..9849841 81..197 100 -> Plus
arm_2R 9848692..9848770 1..80 95 -> Plus