Clone FMO10033 Report

Search the DGRC for FMO10033

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:33
Vector:pMK33-CFH-BD
Associated Gene/Transcriptbl-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10033.5prime Sequence

1096 bp (1013 high quality bases) assembled on 2010-10-30

> FMO10033.5prime
CAGTCGACATGACAAAGAGACTGAGAATGAAGCGTGAAATGAACGATGAA
GGGGAGGGACCACAGGACCAGAAGCGCAATCGCCGCAACGAGGAGACCGT
TCGCATACTGATTCCGAGCAGTATTGCTGGGGCTGTCATTGGCAAAGGAG
GACAGCACATTCAGAAGATGAGGACTCAGTATAAAGCCACTGTGTCTGTC
GACGATTCCCAAGGCCCCGAACGAACCATCCAAATATCGGCGGATATAGA
GTCCACATTGGAGATTATCACCGAAATGCTGAAATACTTTGAGGAGCGCG
ACGAGGACTTTGATGTGCGTCTACTTATACACCAGAGCTTGGCCGGCTGC
GTCATTGGCAAAGGTGGACAAAAGATCAAGGAGATCCGCGATCGCATCGG
CTGCCGCTTTTTGAAGGTCTTCTCGAATGTGGCACCACAGAGCACAGATC
GAGTGGTGCAGACCGTTGGCAAGCAGAGCCAGGTCATCGAAGCGGTTCGT
GAGGTGATCACACTTACACGGGACACTCCCATCAAGGGGGCGATACATAA
CTATGATCCTATGAACTTTGACCGCGTATATGCCGATGAGTACGGTGGCT
ATGGCACTGGAAGTGGCAGTACCCGTCCAAGTCAGCGGGGAAACAATCGT
AACGGAGGAGGCGCTGGAGGTGTTGCCGGCGGCGCAGCCGGTGGCAATGG
TGGAGGATTCAATGCTGGCGGTGCACGCGGCAATGCTGGCGGACGTGGCG
GAGCTGATCGCTTTGGCGGCGCCGCTGGTGGAGCTGTGGCCGGTGCTGGA
ATGGGGCAGCGCGACAATCCGTTCATTAATCCGTGGGCCAATGGCGGTGG
CGGTGATGTAGATGGGTTTGGCAACAACGCTGGTGGTGCTGGTGGATTTG
CCGGTAACAGCTTTGGCGGTGGCGCCGTGGACCATTCGGAGTGGTAGCTT
TGGCAACACCGGTTTCGAGGTGGACCCACCGACTTTGCGGAAATTCGGAA
CTTTGGACAAGGCCATGGCACTAACAGTCTGCCAAGCCTGGTTAGCTTCA
CAGAACAGGGTGACAAACACCCGCCAGCTTGGGCGCTTTGTCCGAA

FMO10033.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:12:02
Subject Length Description Subject Range Query Range Score Percent Strand
bl-RC 2127 CG13425-RC 237..1334 7..1090 4995 97.7 Plus
bl-RF 2078 CG13425-RF 197..1285 16..1090 4950 97.7 Plus
bl-RE 2101 CG13425-RE 195..1283 16..1090 4950 97.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:12:00
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 20604696..20605359 393..1050 2920 97.7 Plus
2R 25286936 2R 20595557..20595663 16..122 535 100 Plus
2R 25286936 2R 20598597..20598694 295..392 490 100 Plus
2R 25286936 2R 20598452..20598525 223..296 370 100 Plus
2R 25286936 2R 20595758..20595814 123..179 285 100 Plus
2R 25286936 2R 20597545..20597591 177..223 235 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:12:01 has no hits.

FMO10033.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:36 Download gff for FMO10033.5prime
Subject Subject Range Query Range Percent Splice Strand
bl-RC 279..1347 1..1062 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:44 Download gff for FMO10033.5prime
Subject Subject Range Query Range Percent Splice Strand
bl-RC 233..1301 1..1062 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:49 Download gff for FMO10033.5prime
Subject Subject Range Query Range Percent Splice Strand
bl-RC 233..1301 1..1062 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:49 Download gff for FMO10033.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 20604696..20605348 393..1039 98 == Plus
2R 20598599..20598694 297..392 100 -> Plus
2R 20598453..20598525 224..296 100 -> Plus
2R 20597548..20597591 180..223 100 -> Plus
2R 20595758..20595814 123..179 100 -> Plus
2R 20595546..20595663 4..122 95 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:44 Download gff for FMO10033.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 16492201..16492853 393..1039 98 == Plus
arm_2R 16486104..16486199 297..392 100 -> Plus
arm_2R 16485958..16486030 224..296 100 -> Plus
arm_2R 16485053..16485096 180..223 100 -> Plus
arm_2R 16483263..16483319 123..179 100 -> Plus
arm_2R 16483051..16483168 4..122 95 -> Plus