Clone FMO10034 Report

Search the DGRC for FMO10034

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:34
Vector:pMK33-CFH-BD
Associated Gene/TranscriptDsp1-RF
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10034.5prime Sequence

1149 bp (1037 high quality bases) assembled on 2010-10-30

> FMO10034.5prime
CAGTCGACATGCTAATGAACATCCATCAACCAACTATTGATCAGCAAACA
ATTCAACACTATCAGCAGCAATTGGCTGCTCAGCAACAACAACAAGTACA
ACAGCAACAGTTGCAACAACACCAGGTGGTCGTCCAGCAGAATCAGCAGC
AGGCGCACCAGAACAGCTCCAATACCACAGCCGGCGTGGGCACCCAACAG
CTGTTCACATACAAAATGGCCAGCAGTTTTCCGAATCCGGCCACGACGAT
GGCCCAAGTGGTGGCCACATCGAACGCAGCCGGCACCACGGGCTATGATT
ATCGTCTAAATATGGCACAGGCAGCCGCAGCAGCAGCCGTACCCGGCTCC
CAGTGGTGGTATTCGGCCGCCAATCAGGGACAGGTCGATGCCAATACAGC
GGCGCAACTGCAGCACCAGCAGCAGCAACAGCAACAGCAACAACAGCAGC
AGCAGCAACAGCACCAGCAGCAACAACAGATGCAACAGCAGCAGCAGCAA
CAGAATGTCATCAATTCGGCGAGCCCCATGAGCAGAGTCAAGGCCGATGC
CAAGCCCAGAGGCCGAATGACCGCCTACGCATACTTTGTACAAACTTGCA
GAGAGGAGCACAAAAAGAAACATCCCGATGAGACGGTGATATTCGCCGAA
TTCTCGCGGAAGTGCGCCGAACGGTGGAAGACAATGGTGGACAAGGAGAA
GAAGCGCTTCCACGAAATGGCCGAGAAGGACAAGCAGCGATATGAGGCGG
AAATGCAGAACTATGTGCCGCCCAAGGGAGCGGTTGTGGGACGCGGCAAG
AAGAGGAAACAGATCAAGGACCCCAATGCTCCAAAACGTTCATTGTCTGC
GTTCTTCTGGTTCTGCAATGACGAGAGAAATAAAGTGAAGGCACTTAATC
CCGAGTTCGGAGTGGCGACATCGCCAAAGAGCTGGGACGAAAGTGGTCCG
ATGTGGATCCCGAGGTCAAGCAAAGTACGAGTCGATGGCCGAGCGGGACA
AGGCTTCGATATGAACGCGAGATGACCGAGTACAGAACGAAGCGGGAAAA
TAGCCATGTCCGCCACCGTCGATGCAGGCGTCGAATGCAGGCGCAGCAAG
AAGACCGCGTACATTTGCCCGCGCTTGCAGCACAGACCAGACGACTGAA

FMO10034.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:12:07
Subject Length Description Subject Range Query Range Score Percent Strand
Dsp1-RF 2205 CG12223-RF 48..1133 9..1096 5255 99.2 Plus
Dsp1-RE 4240 CG12223-RE 263..1315 42..1096 5090 99.1 Plus
Dsp1-RG 2359 CG12223-RG 143..1174 63..1096 4985 99.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:12:04
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 16336231..16336743 9..521 2565 100 Plus
X 23542271 X 16337084..16337251 679..846 840 100 Plus
X 23542271 X 16336850..16337009 521..680 800 100 Plus
X 23542271 X 16337381..16337556 845..1019 720 97.7 Plus
X 23542271 X 16337625..16337699 1019..1096 210 93.6 Plus
Blast to na_te.dros performed 2014-11-26 15:12:05
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2398..2854 40..505 344 57 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2334..2837 24..503 297 58.7 Plus

FMO10034.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:37 Download gff for FMO10034.5prime
Subject Subject Range Query Range Percent Splice Strand
Dsp1-RF 44..1145 9..1110 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:46 Download gff for FMO10034.5prime
Subject Subject Range Query Range Percent Splice Strand
Dsp1-RF 48..1149 9..1110 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:52 Download gff for FMO10034.5prime
Subject Subject Range Query Range Percent Splice Strand
Dsp1-RF 48..1149 9..1110 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:52 Download gff for FMO10034.5prime
Subject Subject Range Query Range Percent Splice Strand
X 16337381..16337555 845..1018 97 -> Plus
X 16337086..16337249 681..844 100 -> Plus
X 16336851..16337009 522..680 100 -> Plus
X 16336231..16336743 9..521 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:46 Download gff for FMO10034.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 16231414..16231588 845..1018 97 -> Plus
arm_X 16231119..16231282 681..844 100 -> Plus
arm_X 16230884..16231042 522..680 100 -> Plus
arm_X 16230264..16230776 9..521 100 -> Plus