Clone FMO10037 Report

Search the DGRC for FMO10037

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:37
Vector:pMK33-CFH-BD
Associated Gene/Transcriptantdh-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10037.5prime Sequence

776 bp (776 high quality bases) assembled on 2010-10-30

> FMO10037.5prime
CAGTCGACATGGAACGCTGGCAGAATCGCGTGGCCGTCGTCACTGGCGCC
AGTTCGGGCATCGGATCGGCCATAGCCAAGGATCTGGTCCTAGCCGGAAT
GACGGTGGTGGGTCTGGCCCGACGTGTCGATCGCGTCAAGGAGCTGCAGA
GGGAGCTGCCGGCGGAGAAGCGCGGCAAACTTTTTGCCCTCTACTGCGAC
GTGGGCAACGAGAGTTCCGTAAACGAGGCCTTCGATTGGATCATCCAAAA
GTTGGGCGCCATCGATGTGCTGGTCAACAATGCCGGCACCCTGCAACCCG
GCTATCTGGTGGACATGAATCCGGCCGTAATGCAGCAGGTATTGCAGACG
AACATCATGGGCATCGTGCTGTGCACCCAGCGAGCGGTGCGTTCCATGCG
GGAGCGCAAGTTCGACGGCCATGTGGTGCTCATCAATAGCATCCTGGGGC
ACAAGACCATGACGGCCACGGAGGGCGTGGCGCCCGATGTGAACGTCTAT
CCGCCCAGCAAGCATGCAGTTACAGCGCTGGCCGAAGGATATCGCCAGGA
GTTCTTCGGCCTGGGCACCCGCATCAAGATTACGAGCGTCAGTCCGGGCG
TGGTGGACACGGAGATCGTGCCGGACAGCATTAGGGAGGCCATCAAGGAT
CGAATGCTCCACTCCGAGGACATCGCACAGGGAGTGCTGTACGCCATCGC
CACACCGCCACATGTCCAGGTGCACGAGCTGATCATCAAGCCACTTGGCG
AGACCATGGCAAGCTTTCTAGACCAT

FMO10037.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:12:13
Subject Length Description Subject Range Query Range Score Percent Strand
antdh-RA 950 CG1386-RA 29..779 8..758 3755 100 Plus
CG10962-RB 1074 CG10962-RB 29..167 9..147 200 77.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:12:11
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 11168454..11169030 584..8 2885 100 Minus
X 23542271 X 11168201..11168375 758..584 875 100 Minus
X 23542271 X 8974089..8974227 147..9 200 76.3 Minus
Blast to na_te.dros performed on 2014-11-26 15:12:12 has no hits.

FMO10037.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:38 Download gff for FMO10037.5prime
Subject Subject Range Query Range Percent Splice Strand
antdh-RA 29..784 8..764 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:49 Download gff for FMO10037.5prime
Subject Subject Range Query Range Percent Splice Strand
antdh-RA 29..784 8..764 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:55 Download gff for FMO10037.5prime
Subject Subject Range Query Range Percent Splice Strand
antdh-RA 29..784 8..764 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:55 Download gff for FMO10037.5prime
Subject Subject Range Query Range Percent Splice Strand
X 11168454..11169030 8..584 100   Minus
X 11168196..11168374 585..764 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:49 Download gff for FMO10037.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 11062487..11063063 8..584 100   Minus
arm_X 11062229..11062407 585..764 98 <- Minus