Clone FMO10038 Report

Search the DGRC for FMO10038

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:38
Vector:pMK33-CFH-BD
Associated Gene/TranscriptOsi15-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10038.5prime Sequence

668 bp (668 high quality bases) assembled on 2010-10-30

> FMO10038.5prime
CAGTCGACATGTGCGCGAAATTCGTATGTGTAGTGCTGCTGGCCAGCCTT
GTGTGCGGTTCCATGGCCCTTCCCTCCCAGGACAACACCGAGCGGGACCT
GGTCAACATGCTGAACCGCTTAGACAGCGAGGAGTCCGTCGCGCTGTTCG
GCGGTCTGAGGATCGACCGGTCGGAGTCGGGCCGTAGCTTCGGTGCATCC
AAGGCCGTCGAGTCCTTCGAGGACCGCGCCGAGCGCTACCTGGAGACCCA
CGAGCTAAACCTCTCCTTCTCCGGCGATGAGCAGGACGAGAACTCCGAGA
ACGAGTACACCGGACGCGCCATGGATGAGTCCCGCAGCAAGCGCATGAAG
AAGATGCTGCTGCCCCTTCTTTTGGCCCTGAAGCTGAAGAAGGCCGTCGT
TGTCAAGATTATGTTCACCATCATCAAGTTCATCTCGCTGAAGGCTCTGG
CCATCTCCTTCCTGGCCCTCATCCTGGCTGGTGCCACCTTCTTCAAGGAT
CTGTTGGCCAAGAAGAAGGAACACATCACCACTGCCTACATCACCGGCAG
CCCGCTGAACGCCGACATCGTGCACTCCGACTGGAGCCGCAATGGTCAGG
CAGGTGCCGCCGATCTGGCCTACAACCACTATGGTCTGGCCCAGCCCTTC
GCAAGCTTTCTAGACCAT

FMO10038.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:12:16
Subject Length Description Subject Range Query Range Score Percent Strand
Osi15-RA 1232 CG1157-RA 110..751 9..650 3210 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:12:14
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 6301913..6302231 9..327 1595 100 Plus
3R 32079331 3R 6303002..6303172 480..650 855 100 Plus
3R 32079331 3R 6302791..6302947 327..483 785 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:12:15 has no hits.

FMO10038.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:39 Download gff for FMO10038.5prime
Subject Subject Range Query Range Percent Splice Strand
Osi15-RA 108..754 9..656 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:51 Download gff for FMO10038.5prime
Subject Subject Range Query Range Percent Splice Strand
Osi15-RA 110..756 9..656 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:58 Download gff for FMO10038.5prime
Subject Subject Range Query Range Percent Splice Strand
Osi15-RA 110..756 9..656 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:58 Download gff for FMO10038.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 6303003..6303177 481..656 98   Plus
3R 6302792..6302944 328..480 100 -> Plus
3R 6301913..6302231 9..327 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:51 Download gff for FMO10038.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 2128725..2128899 481..656 98   Plus
arm_3R 2128514..2128666 328..480 100 -> Plus
arm_3R 2127635..2127953 9..327 100 -> Plus