Clone FMO10039 Report

Search the DGRC for FMO10039

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:39
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG8563-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10039.5prime Sequence

1122 bp (1028 high quality bases) assembled on 2010-10-30

> FMO10039.5prime
CAGTCGACATGTGGCAGGGAATCGTGTGCAGCTTGGCTTTATGCCTCGTC
GGATTGGCGGGTCTCGGCATCGCCAACAATCTCGCCGGCTACGAAGGTTA
TACAAAATACACGGTGCAACATGGAGACGAGAATGCCTTCAAGTACATGG
TCGACCTGCAGACGAATGACGCGGAGCTGGACTTTTGGTTGCTGACCAGA
AACTCCTCCGTGCTGACAGTGAGTCCCCGGCGGAAGACACAGTTCGAGGC
GAGTCTTTCCAGTTTGGGAGTTAGCTACGAGATGCAGCCGCTCATGGAGC
TGATGGCGGCCCTTCAAGCGAACAGTTCCTTTGCGGATGACAACTACGAT
GGGGAGTACGAGGAGTGCCAGCAGGATGAGTGCGAGCAGGCGGAGCGACC
ACGTCGAAGGACTCGTCGTCAGGCTCGCGGCTTCTTCTCGCACTATCCGC
GGTATCATGAGGTGCTCAGCTTCATGAGTGGCTTGGCCGCCAGATATCCT
CAGTTCTGCCGCTATGAATCCTTGGGTCGTTCCAACGAGGGTCGCCACAT
AGCTGCTCTCTCTATTTCACTGAACAGTAGGGTACGTCCTCGTCGAGTGG
CCTATATCCAGGCAGCCACCCACGGTAGGGAGTGGATTACTACGCAGACC
GTTCTCTACTTGGCCTACGAACTGCTGAGCAATCTGCGCGCCTTCACGAG
GGTCCTGCAGGATGTGGAGATCTTTCTGGTGCCGCTGGTCAATCCCGATG
GCTATGAATACACGCACACAACGGATCGTTTCTGGCGCAAGAACCGTCAT
CGTTATGCGGGTCATTCCTGCTCCGGCGTGGACATCAATCGTAACTTTGG
CAATCACTGGAACTATCAGGAGCCAGCCAGATCTCTGCTCGGAGTGTACT
CGGGCACTGCGCCCAATTCGGAGCCGGAGACCTCGGCGGTGGTGCGTATC
TGGAATTCATCGAAACCGTGTGAACTCAGCTGATGTTCACTCATTTGGCT
ATCATTTTTATCCCTACGCTATGCGAAAACACCGTGCACACGGTGACGCT
GCGCTCGGTGATCTGAAGTGCACGATCGCAGTACGTGACGGCCTACCATG
AACTTCGCTCCATTTGTCAAGG

FMO10039.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:12:19
Subject Length Description Subject Range Query Range Score Percent Strand
CG8563-RB 2121 CG8563-RB 690..1760 9..1060 4860 97.9 Plus
CG8563-RA 1786 CG8563-RA 355..1425 9..1060 4860 97.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:12:17
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 7393592..7394269 97..774 3375 99.9 Plus
3L 28110227 3L 7394737..7394846 773..881 500 99.1 Plus
3L 28110227 3L 7391431..7391519 9..97 445 100 Plus
3L 28110227 3L 7394936..7395058 883..999 335 94.3 Plus
Blast to na_te.dros performed on 2014-11-26 15:12:18 has no hits.

FMO10039.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:39 Download gff for FMO10039.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8563-RA 347..1436 3..1074 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:52 Download gff for FMO10039.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8563-RA 349..1438 3..1074 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:59 Download gff for FMO10039.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8563-RA 349..1438 3..1074 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:59 Download gff for FMO10039.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 7394936..7395090 883..1027 92 -> Plus
3L 7394738..7394848 774..882 97 -> Plus
3L 7393593..7394268 98..773 99 -> Plus
3L 7391425..7391519 3..97 96 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:52 Download gff for FMO10039.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 7388036..7388190 883..1027 92 -> Plus
arm_3L 7387838..7387948 774..882 97 -> Plus
arm_3L 7386693..7387368 98..773 99 -> Plus
arm_3L 7384525..7384619 3..97 96 -> Plus