Clone FMO10040 Report

Search the DGRC for FMO10040

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:40
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG15525-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10040.5prime Sequence

509 bp (509 high quality bases) assembled on 2010-10-30

> FMO10040.5prime
CAGTCGACATGGGCATGATGGACAACAATGGCGTCGGCAAGCTGACACAA
GAATCTCTAAAACGCAAGGAGCGTCTGCAAAAACTCCGGGAACAAGTGCA
AAACAAAGGAGGAGACGCTGCCGAGTCCATTGAAAAGTTACCCAAACCAG
TTTTCCGCAGCTACAAGCCCCAGAATGAGACCACCGATGGCGAGATTCTA
GCACAGGAACCCACGGGCAACATAGAATCAGCTGTGGAGGATCAATTGAG
TCTGCTCCAGCAGCCCATGGTGATAGATGAGATTGACATAACCAACCTGG
CTCCCCGAAAACCCGACTGGGATCTGAAGCGGGATGCCAGCAAAAAGTTG
GAGCGACTGGAACGACGTACCCAGAAAGCTATTGCTGAACTCATCCGTGA
GCGACTGAAACTGAACCAAATGGAGGATATCAGCCAAGCGGTGAATGTGG
CCACGGCTCATGCAGGTGAAAGTGTTCAGGAGGATTATGACGCAAGCTTT
CTAGACCAT

FMO10040.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:12:22
Subject Length Description Subject Range Query Range Score Percent Strand
CG15525-RA 654 CG15525-RA 101..585 7..491 2425 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:12:20
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 29997030..29997375 491..146 1730 100 Minus
3R 32079331 3R 29997438..29997576 145..7 695 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:12:21 has no hits.

FMO10040.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:40 Download gff for FMO10040.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7911-RB 573..1068 1..498 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:54 Download gff for FMO10040.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15525-RA 97..592 1..498 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:01 Download gff for FMO10040.5prime
Subject Subject Range Query Range Percent Splice Strand
CG15525-RA 97..592 1..498 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:01 Download gff for FMO10040.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 29997438..29997580 1..145 97   Minus
3R 29997023..29997375 146..498 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:54 Download gff for FMO10040.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 25823160..25823302 1..145 97   Minus
arm_3R 25822745..25823097 146..498 99 <- Minus