Clone FMO10047 Report

Search the DGRC for FMO10047

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:47
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG42361-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10047.5prime Sequence

647 bp (647 high quality bases) assembled on 2010-10-30

> FMO10047.5prime
CAGTCGACATGGAGAAGATCTGGAAGAAGGTGTGCGAGCACCACGATGTG
CCCGCGCAGGTGGCCAACGAGTGGTTCGCCCGCATTCAGCAGCACCTGAG
CTCCGAGGATCCCGCTCGCGCCTACCACAATTGGGAGGAGATGATGCGGC
GCAAGGAGCCGCACTTGGCGGGCGTGGCCAATCCCAACATTGTGCTGGCC
GCCTTCTTCCAGTACTACCACTTCGATGGTAACCGCAGCTGTGCGGAGAA
GAACTGCGAGGTCTTTGAGGAGTTTTGCAATGATGCCGTCATCGAGGATG
ACCATGCAAAAAGCCTGGTATGTAATTTGCTGGGGCGCAAGACCCCGGAG
AACCAGTTGACCTGGTGCCATGACGACGAGGCCAACTTGCTGCAGGACGT
AGACCTGGTGGTCCTAGCTGCTTCGCCGGAGGAGTACAAGCACTATACAA
CTCTCCTTCGCTCGGAGTACGCCAATCTCGACGATGCCACCTACAAGGCC
ATGCGCATCAAGGTGCTGGAGACCCTGCTGATGATTCCCTCCATCTACGC
CACTGGAGACTACCACGACAAGTACGAAGAGCTAGCCCGCGCCAACATAC
GCAACGAGATCAGCGAGCTGAAGAAGCAGGCAAGCTTTCTAGACCAT

FMO10047.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:12:38
Subject Length Description Subject Range Query Range Score Percent Strand
CG42361-RA 1001 CG42361-RA 122..742 9..629 3090 99.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:12:36
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 24607794..24608085 9..300 1445 99.7 Plus
2R 25286936 2R 24608319..24608529 419..629 1055 100 Plus
2R 25286936 2R 24608143..24608261 300..418 595 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:12:37 has no hits.

FMO10047.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:43 Download gff for FMO10047.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42361-RA 99..725 2..633 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:02 Download gff for FMO10047.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42361-RA 119..745 2..633 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:08 Download gff for FMO10047.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42361-RA 119..745 2..633 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:08 Download gff for FMO10047.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 24608319..24608532 419..633 99   Plus
2R 24608143..24608261 300..418 100 -> Plus
2R 24607791..24608084 2..299 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:02 Download gff for FMO10047.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 20495842..20496055 419..633 99   Plus
arm_2R 20495666..20495784 300..418 100 -> Plus
arm_2R 20495314..20495607 2..299 98 -> Plus