Clone FMO10049 Report

Search the DGRC for FMO10049

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:49
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG42393-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10049.5prime Sequence

431 bp (431 high quality bases) assembled on 2010-10-30

> FMO10049.5prime
CAGTCGACATGTGTAAATCGTGTGAGGAACAACCAGTTCGGTGCTGCTCA
ATTTTCTATGCCGCTTTCTGCATTTCATGCGGTCTCTTCATGCTCATTTT
TTCGATTCACAATGTAATACTTTTGAAAAGCTCTATTACAGTCGTGGATT
TTTATTTGCATATGCATGGTGCTGACATGTCTCCCTCAACTTTCCGCATC
CTTTACTCGATGGATGTGATTTTTGCCCTTTCGTACGTCATTGCTGGAAC
TTTACTAGCTGTTGGAATCCACCTGAACTCAAAGGGGGTCTTCTTCGCTG
GCAAGATCATAAGCTATTTCTTTCCAATATATAACATCCTTTATGTATTT
CCTTTAATTGTGCACATTGCCGCCACAGTGAAATTATGCAGATATCTTAA
AGAGAACTTTAATGCAAGCTTTCTAGACCAT

FMO10049.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:12:45
Subject Length Description Subject Range Query Range Score Percent Strand
CG42393-RA 1142 CG42393-RA 112..516 9..413 2025 100 Plus
CG32192-RC 983 CG32192-RC 386..499 297..410 225 80.9 Plus
CG32192-RB 992 CG32192-RB 395..508 297..410 225 80.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:12:43
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 18042844..18043110 9..275 1335 100 Plus
3L 28110227 3L 18043185..18043267 275..357 415 100 Plus
3L 28110227 3L 18043326..18043386 353..413 290 98.4 Plus
3L 28110227 3L 18040784..18040843 297..356 195 88.3 Plus
Blast to na_te.dros performed on 2014-11-26 15:12:44 has no hits.

FMO10049.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:44 Download gff for FMO10049.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42393-RA 112..522 9..421 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:05 Download gff for FMO10049.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42393-RA 112..522 9..421 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:11 Download gff for FMO10049.5prime
Subject Subject Range Query Range Percent Splice Strand
CG42393-RA 112..522 9..421 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:11 Download gff for FMO10049.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 18043331..18043392 358..421 93   Plus
3L 18043186..18043267 276..357 100 -> Plus
3L 18042844..18043110 9..275 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:05 Download gff for FMO10049.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 18036431..18036492 358..421 93   Plus
arm_3L 18036286..18036367 276..357 100 -> Plus
arm_3L 18035944..18036210 9..275 100 -> Plus