Clone FMO10050 Report

Search the DGRC for FMO10050

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:50
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG14292-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10050.5prime Sequence

530 bp (530 high quality bases) assembled on 2010-10-30

> FMO10050.5prime
CAGTCGACATGAAATTCGCAATTGTTCTACTGGCGGCCAGCATTGCCTGC
ATCAGTGCACAGGGCCCTGGAGCTACTGTTGGAAATCCCCTTGCCGGAAA
TCCCTTTGCCGCCGCCAATCCGTATGCGGCTGCCTTTAATCCCTTCCTAA
ATGGAATTTTCGGAGGTGCTGGCACAGGAGCTGCCGCCGGTGTAGCCGCT
CCCGTGGCACCGTCTGCTCCCTTTGGAGGCGCCTCGATTTCCTCATTCTT
CCAGTCGATAGTCCTGCAACGCGAAGCCGAGCGTCTGCTCTCCCAGCCTG
ACTTTCCCGCCGACCTGGCGGAGCGCGTCCTGGATGTGGTGGCCACCTCG
GAGGAGTCGATCAGTGGCTGCAACAACGCCACTTTGCCCTGGCTGCAGAT
ACGCTGTGTCAAGCCTCTGCTGACCACGGCCAAGAACCAGCTGAAGGCCA
TCGATGACGAGTGGCAGGCCCGTTTGGCCGCCACCGCCAGTCCCACAGGA
GCAGCTGCTGCCGCAAGCTTTCTAGACCAT

FMO10050.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:12:49
Subject Length Description Subject Range Query Range Score Percent Strand
CG14292-RA 648 CG14292-RA 50..553 9..512 2520 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:12:47
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 18905028..18905479 512..61 2260 100 Minus
3R 32079331 3R 18905552..18905606 63..9 275 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:12:48 has no hits.

FMO10050.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:45 Download gff for FMO10050.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14292-RA 47..560 6..520 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:07 Download gff for FMO10050.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14292-RA 47..560 6..520 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:13 Download gff for FMO10050.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14292-RA 47..560 6..520 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:13 Download gff for FMO10050.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 18905553..18905609 6..62 98   Minus
3R 18905021..18905477 63..520 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:07 Download gff for FMO10050.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 14731275..14731331 6..62 98   Minus
arm_3R 14730743..14731199 63..520 99 <- Minus