Clone FMO10054 Report

Search the DGRC for FMO10054

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:54
Vector:pMK33-CFH-BD
Associated Gene/Transcriptnuf-RD
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10054.5prime Sequence

968 bp (968 high quality bases) assembled on 2010-10-30

> FMO10054.5prime
CAGTCGACATGTATGTGAAATATCCCATGGCTGAGGTGCAGTTGGTGAAC
GATCTTCTCCTCGATCTGCGGCACATGAAAAAAGATTGTCTGGAACTGCT
GCAGCGCAAGGTGGACGATCTGTCAGATACACAGAATATAGCTGAGGATC
GGACAACCCGCACCAAGACCGAATATGCAGTCCTTCAGGCGCGTTATCAC
ATGCTCGAAGAGCAGTACCGAGAGTCGGAACTGCGTGCCGAGGAGCGTTT
GGCAGAGGAGCAGAAGCGGCACCGCGAGATTTTGGCCCGCGTGGAGCGTG
AAGCCTCGCTGCAGAACGAGAACTGCCAGATGAAGATCCGTGCCACCGAG
ATCGAGGCAACGGCACTGCGGGAAGAAGCCGCCCGACTGCGTGTCCTGTG
TGACAAGCAGGCCAATGACCTCCATCGCACCGAGGAACAGTTGGAGCTGG
CGCGCGACCAAATCGGCGTCCTGCAACAGGAGCACGAGGAGCAGGCACAG
GCACTGCGCCGCCACGAACAGGAGAAGAAGTCCACCGAGGAGCTGATGCT
GGAGCTGGGCCGGGAACTGCAGCGTGCTCGCGAGGAGAGTGGAGCCCGGG
CAATGCCGACCACATCGCCGGAGAGCATAAGACTGGAGGAGCTGCATCAG
GAGCTCGAGGAGATGCGCCAGAAGAACCGAACCCTCGAAGAACAGAACGA
GGAGCTGCAGGCCACGATGCTGACCAACCAGGCCACCATGCTGACAAATG
GCGTGGAGCAGGGTCGCCATCTGCTGAACGAACACTCAACAGTTTGGCTC
AGAGCTCGAGGAGATGTCACAAGCCCAGCTACAACAGGCCTTCCAGGAAA
AGGAGGATGAAAATGTTCGGCTTAAGCACTATATTGATACCATTCTACTC
ACATCGTGGAGAACTATCCTCATTGCTGGAGTCAAGCCCATGAGCGAAAG
GCAAGCTTTCTAGACCAT

FMO10054.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:13:04
Subject Length Description Subject Range Query Range Score Percent Strand
nuf-RD 2448 CG33991-RD 303..1250 9..950 4590 99.4 Plus
nuf-RF 3099 CG33991-RF 1035..1901 90..950 4185 99.3 Plus
nuf-RE 3233 CG33991-RE 1169..2035 90..950 4185 99.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:13:02
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 14230654..14231112 223..681 2295 100 Plus
3L 28110227 3L 14230176..14230310 90..224 675 100 Plus
3L 28110227 3L 14231177..14231325 682..828 645 98.7 Plus
3L 28110227 3L 14231924..14232043 826..942 450 97.5 Plus
3L 28110227 3L 14230026..14230106 9..89 405 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:13:03 has no hits.

FMO10054.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:47 Download gff for FMO10054.5prime
Subject Subject Range Query Range Percent Splice Strand
nuf-RD 294..1248 1..950 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:14 Download gff for FMO10054.5prime
Subject Subject Range Query Range Percent Splice Strand
nuf-RD 296..1250 1..950 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:18 Download gff for FMO10054.5prime
Subject Subject Range Query Range Percent Splice Strand
nuf-RD 296..1250 1..950 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:18 Download gff for FMO10054.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 14231927..14232052 829..950 96   Plus
3L 14231177..14231325 682..828 98 -> Plus
3L 14230656..14231112 225..681 100 -> Plus
3L 14230176..14230310 90..224 100 -> Plus
3L 14230019..14230106 1..89 95 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:14 Download gff for FMO10054.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 14225027..14225152 829..950 96   Plus
arm_3L 14224277..14224425 682..828 98 -> Plus
arm_3L 14223756..14224212 225..681 100 -> Plus
arm_3L 14223276..14223410 90..224 100 -> Plus
arm_3L 14223119..14223206 1..89 95 -> Plus