Clone FMO10055 Report

Search the DGRC for FMO10055

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:55
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG30269-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10055.5prime Sequence

458 bp (458 high quality bases) assembled on 2010-10-30

> FMO10055.5prime
CAGTCGACATGGATTCCGTCTATCCAGCTGCACCCTTGGAGGCGCCCAAG
GGATCCGTCGAGCTGCAGGCGACACCCGAGCAACAACACCTTCTGCCACC
GGCTCCACCCAGTTACGACCAGGCCACAACCACTCCGGCTGAAACCACGG
GACCAGCTCCAGTTCCAGCGAGCACATCCACCACACAGCACACGGTCGTC
GTGGTGCCCGGTTCACCGTACGGCCCGGAGCCCATGGACGTGCAGTGCCC
GTACTGCCACAATTACGCCCGGACACGGGTCTCCTTCAAGCCCAACTCGC
GCACCCATCTGATAGCCTTGATATTATGCCTGTTCCAGTTGTACTGCTGT
GTGTGTCTGCCGTACTGCATTTCCAGTTGCATGAACACCAATCACTACTG
TGGCATGTGCGATCGTTATTTGGGCACCTACGATCGCAAAGCAAGCTTTC
TAGACCAT

FMO10055.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:13:09
Subject Length Description Subject Range Query Range Score Percent Strand
CG30273-RB 1234 CG30273-RB 705..1137 8..440 2165 100 Plus
CG30269-RB 1234 CG30269-RB 705..1137 8..440 2165 100 Plus
CG30269-RA 577 CG30269-RA 48..480 8..440 2165 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:13:06
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 22667986..22668317 8..339 1660 100 Plus
2R 25286936 2R 22668649..22668751 338..440 515 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:13:08 has no hits.

FMO10055.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:48 Download gff for FMO10055.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30269-RA 45..482 8..446 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:15 Download gff for FMO10055.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30269-RA 48..485 8..446 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:20 Download gff for FMO10055.5prime
Subject Subject Range Query Range Percent Splice Strand
CG30269-RA 48..485 8..446 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:20 Download gff for FMO10055.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 22668649..22668756 338..446 97   Plus
2R 22667986..22668315 8..337 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:15 Download gff for FMO10055.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 18556154..18556261 338..446 97   Plus
arm_2R 18555491..18555820 8..337 100 -> Plus