Clone FMO10056 Report

Search the DGRC for FMO10056

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:56
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG7101-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10056.5prime Sequence

1150 bp (1004 high quality bases) assembled on 2010-10-30

> FMO10056.5prime
CAGTCGACATGGAACCGGTGCCCATCCGGCCAAAAGCGCCGGGAGCGAGC
AACCGCGGAGCCCTGCCGCTGGCGGCGAAGAAGCCGGCCAAGAAGCGTAC
GTACCACTGCGGCGTTTGTTTTGCGGAGTTCTCTCGTCATCTGGCCGCCA
AGCGGCACGAGCAGCAGTGCTCCGTCAGGGTGAGGCGTCTTTTCGTCTGC
CCCCACTGCCTGACGCTTTTCGGCGAGGAGGCCCGGCTGGAGCGGCATCG
GGAGCGAAAGCACAACGATGGCCAGTTCCTGTGCCTGCAGTGCGGCAAGA
AGTACGCGTCAGCCACGTTTCTTTACCGTCATGTTGCCAGTTGGCACGGC
CAGCAGTCGCTGTTCTACTGCGACATGTGCACGGACAACTGCAACGACGT
TAAGACCTTTAGCGGGATGCTGGAGCTGCAGGAGCACGCCGAGGAGGTGC
ATCGCCTGCGTACCCTGAAGTCCACGGCCAGTGATGCAGACAGCCAGGTT
GATGAAATGGAGGATCTTGAGATGCTAGAGGAGAACATTGAGAACATACT
GCCCAGCATCGACTGGGACGACGATCTCACCTTTGGCTGGCCCACCGACC
TGGACAAGGAGTCGTGCATTGTGAACGCTAAGCCGAGCGTTTTCGTGTGT
CCCTTCTGCGCCAACGGATTCCCCGGCAGTCTGAGCCTGGTGCGGCACCT
GGAGCAGGTTCACGAACGCAGTGCCCTGGACTGCTGCTACTGTGGCAAGA
GCCATGGCAGCCGAGAAGCCCTGCGGTCCCATCTGCAACGTGTTCACATC
CTCTTGCGCGGTCATGTGTGCGGTATTTGCCAGGCGGACTTCGCCACTGC
TGATCACCTAAAGAAGCACGTTAACAGTCTGCACCTGGACCACCGACCGC
ATCTGTGTCCCACGTGCGAAAGAGATTCACCCAGCGGTGCCACCTCACCG
ATCACATAAAGACGGATCGCGGCCATGGACAACGGCACTTACACTGTGAA
TTCTGCTGCCGACCTTCTCCGGTCATCGATCTCGACGGATTGTGTGTGAG
ACATCCGCAGCTTCTAAACATCGTTTGCGCGCGCGGGCCAGTAATTGGCT
ATCCTAATCTGATGTCATAATCCTATCAACACTATGCCTAGGAAATTCTG

FMO10056.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:13:13
Subject Length Description Subject Range Query Range Score Percent Strand
CG7101-RA 1454 CG7101-RA 73..1128 9..1057 4995 98.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:13:10
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 18831218..18831740 485..1006 2470 99.4 Plus
X 23542271 X 18830663..18831143 9..489 2405 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:13:12 has no hits.

FMO10056.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:48 Download gff for FMO10056.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7101-RA 58..1113 9..1057 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:18 Download gff for FMO10056.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7101-RA 73..1128 9..1057 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:22 Download gff for FMO10056.5prime
Subject Subject Range Query Range Percent Splice Strand
CG7101-RA 73..1128 9..1057 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:22 Download gff for FMO10056.5prime
Subject Subject Range Query Range Percent Splice Strand
X 18831223..18831797 490..1057 97   Plus
X 18830663..18831143 9..489 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:18 Download gff for FMO10056.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 18725256..18725830 490..1057 97   Plus
arm_X 18724696..18725176 9..489 100 -> Plus