Clone FMO10058 Report

Search the DGRC for FMO10058

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:58
Vector:pMK33-CFH-BD
Associated Gene/Transcriptinx7-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10058.5prime Sequence

1131 bp (1020 high quality bases) assembled on 2010-10-30

> FMO10058.5prime
CAGTCGACATGCTGAACACCTTCAGTTCGGTGAGGCAGTACCTCAAGTTC
GATCTCACGCGTGTGGTCATCGACAATATAGTGTTCAAGCTGCACTATCG
ATGGACCTTCGTAATACTCCTAGTGGCCACCCTCCTGATCACGTCGCGCC
AGTACATCGGGGAGCACATCCAGTGCCTATCCGACGGTGTTGTGTCTCCG
GTCATCAACACCTTCTGCTTCTTCACGCCCACCTTCACAGTGGTACGTGA
CCAGAACCAAACTGCCTACAGGCCGGGAAGTGAGCCACCTGGTATAGGGG
CATTCGATCCCGAAAAGGACACGATCAAGCGGCATGCATACTACCAGTGG
GTGCCCTTTGTCCTGTTCTTCCAGGCTCTCTGCTTCTACATTCCCCATGC
CCTGTGGAAGAGTTGGGAGGGCGGCCGGATCAAGGCCCTGGTCTTTGGTC
TTCGAATGGTGGGTCTAACGAGGTACCTGAAGAACGATAGTCTGCGTATC
GGCAAGCTGAACATTCCCTCGATGGCGGAGGCGGAGGAGCGGGTCAAGGA
CATTCGTCGCACAATGATCGACCGGATGCGGCTGAATCAATCGTGGGGTG
CCCACTTGGTCTTCGCGGAGGTGCTCAATCTGATTAATCTTCTGCTGCAG
ATCACATGGACCAACCGTTTTTTGGGCGGTCAATTCCTCACACTGGGACC
ACATGCCCTGAAAAATCGGTGGTCCGACGAGCTGAGCGTTTTGGATCTAG
TATTCCCGAAGATTACCAAGTGCAAGTTCCACAAATTTGGTGACTCTGGC
TCCATTCAAATGCACGATGCCCTTTGCGTGATGGCGCTGAACATCATGAA
CGAGAAGATCTACATTATTCTGTGGTTCTGGTACGCCTTCCTTTTGATTG
TACTGTTCTGGGACTGCTTTGGAGATTTTAACCCTGTGCTTCTACAGAAA
TGTCACATTTACCCGCTGGTCTCTCTATGGGCAAGCTGTCACTGGACGAA
ACGAATTATTGGCGGTAATGATAATGTACTTTCCAACTGATGTTCTTTTC
TTCCTGGCGTTCAACCTTTCGATCCATTTCAGAAGGTATCTATCTTTGGC
TATGAATACATCGATACCATACAAGTCATGG

FMO10058.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:13:17
Subject Length Description Subject Range Query Range Score Percent Strand
Inx7-RA 1634 CG2977-RA 200..1313 9..1102 4970 97.6 Plus
Inx7-RB 1690 CG2977-RB 488..1369 241..1102 3810 96.9 Plus
Inx3-RC 1652 CG1448-RC 864..981 765..882 185 77.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:13:15
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 6992173..6992883 950..242 3440 99.6 Minus
X 23542271 X 6993177..6993413 245..9 1185 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:13:16 has no hits.

FMO10058.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:49 Download gff for FMO10058.5prime
Subject Subject Range Query Range Percent Splice Strand
inx7-RA 188..1271 1..1071 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:19 Download gff for FMO10058.5prime
Subject Subject Range Query Range Percent Splice Strand
Inx7-RA 193..1276 1..1071 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:24 Download gff for FMO10058.5prime
Subject Subject Range Query Range Percent Splice Strand
Inx7-RA 193..1276 1..1071 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:24 Download gff for FMO10058.5prime
Subject Subject Range Query Range Percent Splice Strand
X 6993180..6993420 1..242 98   Minus
X 6992173..6992882 243..950 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:19 Download gff for FMO10058.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 6887213..6887453 1..242 98   Minus
arm_X 6886206..6886915 243..950 99 <- Minus