Clone FMO10060 Report

Search the DGRC for FMO10060

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:60
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG32195-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10060.5prime Sequence

1175 bp (1054 high quality bases) assembled on 2010-10-30

> FMO10060.5prime
CAGTCGACATGGAGCGGGAAATTTACAGTGCGGAATACTTCGAGAGAGCT
TTGGCGAGAGCTTATGGTTGTGAAATGCTTCGCGTTGAGAACTTTCACAT
CAAGGCGGTGAGCCAGAAGGGCGAGAACTTTTGCAGCGTCATCTACCGGG
TGGCGTTGGTCTTTCGCAGGTCACCCGATGGCGCTCTCGAATCAGGAAAA
TATATTCTCAAGGATCTGCTGCCCGCCGCCGCTGCACTGGGCACCAACGA
AAAGGATATGTTCGAGGTACTCCTGCCTGCCATGCAAGCCATTCTTGAAG
AAGCTCCAAAGGAGATTGGCGAACACAAGCTGAGCGCAGATTGCTTGCTA
GTCGAGATATCTGCTGGAAAAGAGCTCTACATTCTGGAGGATCTGGGCGC
CCTAGGATACGAATCCTTTGATCGTCGTCAAGGCTTAAATCTGGAAGAAG
CCAAAATTTGCGTAAGGAAACTGGCTCAGTTCCACGGTGCATCCAAGGTT
TTGTACGAGAAGAAACCCGAATTGATTCAAAGGCTTTCGCCTTCTCACTA
TGCCAATGGATTGAACGATCGCTTCGCCCAGGCTCTCGTCTTGGAGGGCG
CCGAATATGCCGCAGAAGCGTTTGCCGAAGAACTTCCGGAAATATCAAAG
AAAATGAAGGCTCAAATACCGAAAGCATATACGAAAAGAATGCGAGATGT
CGTTGATCCAAACAAGTCATCATTGAATGCAGTTATTCATGGTGATCCCT
GGTTAAATAACATTATGTTTGATTTCGTTAATAAGAAGGCAACACTTGTG
GATTTCCAAAACTGTTACTGGGGTAGCCCGGCCATAGATCTCTACTTTCT
ATTTTACACCAGCCTCAAGCCTGAATTATTGCTAAATAATCAAGATGAGC
TTCTGAATTACTATTTCGACAATCTTCTGGAAACCCTGCGGCATTGCGGC
TATAAAGACAAACTGCCCACTTTTGGCCAGTTAAAGGATGAGATGAAACG
GTGTTTGTTTTATGGAATATTACACTGTAGTCTGGTGAACTTCCCATATG
TTGTGCTTCCCCTGAAGCCAGTGTTGGATTTCGGGGTTCACACCCTTCGT
AAATACCGGATGCCTATGTTAAAAAGCGACACCAATATATTCCGCCACGA
ACGAGTGCTTAACATAAGCCACTGC

FMO10060.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:13:21
Subject Length Description Subject Range Query Range Score Percent Strand
CG32195-RC 1563 CG32195-RC 143..1286 9..1158 5450 98.8 Plus
CG32195-RB 1701 CG32195-RB 281..1424 9..1158 5450 98.8 Plus
CG32195-RA 4876 CG32195-RA 281..1424 9..1158 5450 98.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:13:19
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 18114823..18115282 341..800 2300 100 Plus
3L 28110227 3L 18114426..18114757 9..340 1660 100 Plus
3L 28110227 3L 18115344..18115677 798..1136 1295 95.6 Plus
Blast to na_te.dros performed on 2014-11-26 15:13:20 has no hits.

FMO10060.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:49 Download gff for FMO10060.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32195-RA 270..1413 9..1158 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:21 Download gff for FMO10060.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32195-RA 281..1424 9..1158 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:27 Download gff for FMO10060.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32195-RA 281..1424 9..1158 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:27 Download gff for FMO10060.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 18115344..18115698 798..1157 95 -> Plus
3L 18114823..18115279 341..797 100 -> Plus
3L 18114426..18114757 9..340 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:21 Download gff for FMO10060.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 18108444..18108798 798..1157 95 -> Plus
arm_3L 18107923..18108379 341..797 100 -> Plus
arm_3L 18107526..18107857 9..340 100 -> Plus