Clone FMO10062 Report

Search the DGRC for FMO10062

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:62
Vector:pMK33-CFH-BD
Associated Gene/Transcriptfbp-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10062.5prime Sequence

1044 bp (1027 high quality bases) assembled on 2010-10-30

> FMO10062.5prime
CAGTCGACATGGCGGCCAGTAGCGGTGATTCCAAAATGACCCAACAGAGG
CCAGCTTTCGACTCCAATGCGATGACGCTGACGCGTTTCGTGCTGCAGGA
GCAGCGAAAGTTCAAGAGCGCCACTGGCGATCTCTCCCAGCTGCTCAACT
CCATCCAGACCGCCATCAAGGCTACATCATCCGCGGTGCGGAAGGCAGGT
ATCGCCAAGCTCCATGGATTCGCTGGCGACGTGAATGTCCAAGGCGAGGA
GGTCAAGAAACTGGACGTGCTCTCCAACGAGCTGTTCATCAACATGCTGA
AGTCATCCTATACCACATGTCTAATGGTTTCCGAGGAGAACGAGAATGTG
ATCGAGGTGGAAGTGGAGAAACAGGGCAAATACATCGTGTGCTTCGATCC
CTTGGATGGATCCTCCAACATAGACTGCCTGGTGTCGATCGGTTCAATCT
TCGCCATTTACCGCAAGAAAAGCGATGGTCCGCCCACAGTGGAGGATGCA
CTGCAGCCCGGAAATCAGCTGGTGGCCGCCGGCTACGCGCTATACGGTTC
GGCCACAGCAATTGTCCTGGGTCTGGGTTCGGGAGTGAATGGCTTCACTT
ATGACCCGGCCATCGGAGAGTTCGTGCTGACCGATCCCAACATGCGGGTG
CCGGAGAAGGGAAAGATATACTCTATCAACGAGGGATATGCAGCGGATTG
GGAGGATGGTGTCTTCAACTACATTGCGGCCAAGAAGGATCCCGCCAAGG
GAAAGCCCTATGGAGCGCGGTACGTGGGTTCCATGGTCGCGGATGTGCAT
CGCACCATTAAATACGGCGGCATCTTTATCTATCCGGCAACAAGTCCGCT
CCCAGCGGAAACTTCGTCTGCTGTACGAGTGCGTGCCCATGGCCTATCTG
ATGATCCAGGCTGGAGTCTGGCCAGCGACGGAAAGATCAGCATTTTGGAC
ATTGTGCCCAGAGATCCACGAGCGCAGTCCCATATTCCTAGGATCCAGTC
GACGTGAGAGCACTTTGCTACTTAAGGGCAGCTTTCTAGAACAT

FMO10062.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:13:30
Subject Length Description Subject Range Query Range Score Percent Strand
fbp-RE 1202 CG31692-RE 118..1144 9..1025 4870 98.9 Plus
fbp-RA 1130 CG31692-RA 66..1072 29..1025 4770 98.9 Plus
fbp-RD 1185 CG31692-RD 140..1127 48..1025 4675 98.9 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:13:28
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 19761678..19762308 997..372 2925 99 Minus
2L 23513712 2L 19762487..19762831 375..31 1725 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:13:29 has no hits.

FMO10062.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:51 Download gff for FMO10062.5prime
Subject Subject Range Query Range Percent Splice Strand
fbp-RB 111..1132 1..1015 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:25 Download gff for FMO10062.5prime
Subject Subject Range Query Range Percent Splice Strand
fbp-RE 113..1134 1..1015 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:30 Download gff for FMO10062.5prime
Subject Subject Range Query Range Percent Splice Strand
fbp-RE 113..1134 1..1015 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:30 Download gff for FMO10062.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 19762488..19762831 31..374 100 <- Minus
2L 19761655..19762305 375..1015 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:25 Download gff for FMO10062.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 19762488..19762831 31..374 100 <- Minus
arm_2L 19761655..19762305 375..1015 98 <- Minus