Clone FMO10063 Report

Search the DGRC for FMO10063

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:63
Vector:pMK33-CFH-BD
Associated Gene/TranscriptZasp66-RH
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10063.5prime Sequence

431 bp (431 high quality bases) assembled on 2010-10-30

> FMO10063.5prime
CAGTCGACATGGAGTACGTTCAGTTCAAAAACGGATCCCCAGTCTACTAC
AAGGAGCAGCCAGACCTCAATGAGTGCATTCAATACCAACCCTACCGTAC
AACTCCGCTGGTCCTGCCCGGCGCCAAAGTGAAGAAGGATGCGCCCACGA
CAGAGTCCTACTTGAGGCACTACCCCAACCCGGCTGTGCGCGCCCACCCA
GGACACGACTACCATGACAGTATCATGAAGCAGCGCGTGGCCGACACCAT
GCTGCACAAGGTGGTCGGTTCGGAAGCCGACACTGGCCGCGTCTTCCACA
AGCAATTCAACTCGCCCATTGGCCTGTACTCCAACAACAACATCGAGGAC
ACCATCAGATCCACAGTTCCAAACCAGTATCAGCGCCAGTATCCCGGCCG
CCGTACAATGTGGGCAAGCTTTCTAGACCAT

FMO10063.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:13:34
Subject Length Description Subject Range Query Range Score Percent Strand
Zasp66-RH 1120 CG6416-RH 173..577 9..413 2025 100 Plus
Zasp66-RG 786 CG6416-RG 173..536 9..372 1820 100 Plus
Zasp66-RI 1280 CG6416-RI 173..534 9..370 1810 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:13:31
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 8634579..8634785 86..292 1020 99.5 Plus
3L 28110227 3L 8630555..8630635 9..89 405 100 Plus
3L 28110227 3L 8635002..8635081 291..370 400 100 Plus
3L 28110227 3L 8638157..8638198 371..412 210 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:13:32 has no hits.

FMO10063.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:51 Download gff for FMO10063.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6416-RH 167..574 9..417 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:26 Download gff for FMO10063.5prime
Subject Subject Range Query Range Percent Splice Strand
Zasp66-RH 173..580 9..417 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:31 Download gff for FMO10063.5prime
Subject Subject Range Query Range Percent Splice Strand
Zasp66-RH 173..580 9..417 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:31 Download gff for FMO10063.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 8638157..8638204 371..419 93   Plus
3L 8635002..8635081 291..370 100 -> Plus
3L 8634583..8634783 90..290 100 -> Plus
3L 8630555..8630635 9..89 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:26 Download gff for FMO10063.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 8631257..8631304 371..419 93   Plus
arm_3L 8628102..8628181 291..370 100 -> Plus
arm_3L 8627683..8627883 90..290 100 -> Plus
arm_3L 8623655..8623735 9..89 100 -> Plus