Clone FMO10066 Report

Search the DGRC for FMO10066

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:66
Vector:pMK33-CFH-BD
Associated Gene/TranscriptPHGPx-RD
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10066.5prime Sequence

740 bp (740 high quality bases) assembled on 2010-10-30

> FMO10066.5prime
CAGTCGACATGAGTCTCAGGCAGTTTCAGAACATTTCCCGCCAGGCCCTC
AGGTGCTACTCGATGAGGCGGACCCCTGGCCCCGTCCTCGAGCTGAGTCG
CGGTCAGAGGCAGTGCCTTCGCCTCTGCACCATCATGCTTCCCGTGAGCT
GTGCGGCCACGCCCATGAACGCCATCTCCTCAGCCGCCCAGCACTCCACA
GCAGCTGCCATCGACATGTCTGCTAACGGAGATTACAAGAACGCCGCCTC
GATCTACGAGTTCACCGTGAAGGATACCCATGGCAACGATGTTTCCCTGG
AAAAGTACAAGGGCAAGGTGGTCCTGGTGGTGAACATCGCCTCCAAGTGC
GGCCTGACCAAGAACAACTACGAGAAGCTGACGGATCTAAAGGAGAAGTA
CGGCGAGCGCGGCCTGGTGATCCTCAACTTCCCGTGCAATCAGTTTGGGT
CCCAGATGCCGGAGGCCGATGGAGAGGCCATGGTGTGCCACCTGCGCGAC
TCCAAGGCTGACATCGGCGAGGTGTTCGCCAAGGTCGATGTGAATGGAGA
CAATGCGGCGCCGCTGTACAAATACCTAAAGGCCAAGCAGACCGGCACCC
TGGGCAGCGGAATCAAGTGGAACTTCACCAAGTTTCTGGTGAACAAGGAG
GGCGTGCCCATCAACCGATATGCCCCGACCACCGATCCCATGGACATCGC
CAAGGACATTGAAAAGCTGCTGGCAAGCTTTCTAGACCAT

FMO10066.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:09:40
Subject Length Description Subject Range Query Range Score Percent Strand
PHGPx-RD 1014 CG12013-RD 114..827 9..722 3570 100 Plus
PHGPx-RA 803 CG12013-RA 104..616 210..722 2565 100 Plus
PHGPx-RC 1148 CG12013-RC 449..961 210..722 2565 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:09:38
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 3327860..3328185 210..535 1630 100 Plus
3L 28110227 3L 3327353..3327553 9..209 1005 100 Plus
3L 28110227 3L 3328249..3328439 532..722 955 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:09:39 has no hits.

FMO10066.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:15 Download gff for FMO10066.5prime
Subject Subject Range Query Range Percent Splice Strand
PHGPx-RD 80..795 6..722 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:54:34 Download gff for FMO10066.5prime
Subject Subject Range Query Range Percent Splice Strand
PHGPx-RD 112..827 6..722 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:50:46 Download gff for FMO10066.5prime
Subject Subject Range Query Range Percent Splice Strand
PHGPx-RD 112..827 6..722 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:50:46 Download gff for FMO10066.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 3328251..3328439 534..722 100   Plus
3L 3327860..3328183 210..533 100 -> Plus
3L 3327351..3327553 6..209 99 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:54:34 Download gff for FMO10066.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 3328251..3328439 534..722 100   Plus
arm_3L 3327860..3328183 210..533 100 -> Plus
arm_3L 3327351..3327553 6..209 99 -> Plus