Clone FMO10068 Report

Search the DGRC for FMO10068

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:68
Vector:pMK33-CFH-BD
Associated Gene/Transcriptscramb1-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10068.5prime Sequence

725 bp (725 high quality bases) assembled on 2010-10-30

> FMO10068.5prime
CAGTCGACATGAGTATACCTACCGGAATTCCGAACTGTCCGCGCGGATTG
GAGTACCTTACGACTATCGACCAGCTTTTAGTTAAGCAAAAGGTCGAGCT
GCTCGAGGCCTTCACTGGTTTCGAGACCAACAACAAGTTCACGATCAAGA
ACGCCCTGGGTCAGAAGGTCTATTTCGCGGCGGAGGACAACGACTGCTGC
ACGCGCAATTGCTGTGGTCCTGCGCGTCCCTTCGACATGCGGGTCTTTGA
TAACTTCCAGCAGGAAGTGATCCACATGCACCGCCCGCTGGCCTGCTCCT
CCTGTCTGTTTCCCTGCTGTCTGCAGAGTATCGAGGTCTCGGCACCACCC
GGCAATGTTATCGGCACCATTGAGCAGGAGTGGTCCATCTGTTCGCCATC
CTTCCGCATCCTCAACCACGTGGGTGACACGGTGATGCGCATCGAAGGAC
CTTTCTGCACCTTTTCGCTCTGCGGCGACGTTGAGTTCAATGTTGTTTCG
CTCACTGGTGAGAAGATAGGCAAGATCTCGAAACAGTGGTCGGGCCTGGC
ACGTGAAATTTTCACGGATGCGGACTTCTTCGGCATCAATTTCCCACTGG
ACTTGGATGTGCGCATGAAGGCCGTTTTGCTGGGTGCCACATTCCTCATA
GATGCCATGTTCTTTGAGAAAGCCGGAAACCAAGAGACCGATAGGCCCGG
AATGCTTGCAAGCTTTCTAGACCAT

FMO10068.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:09:43
Subject Length Description Subject Range Query Range Score Percent Strand
scramb1-RC 1640 CG32056-RC 348..1049 6..707 3495 99.9 Plus
scramb1-RB 1655 CG32056-RB 364..1062 9..707 3495 100 Plus
scramb1-RA 2049 CG32056-RA 760..1458 9..707 3495 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:09:41
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 10221609..10222093 493..9 2425 100 Minus
3L 28110227 3L 10221393..10221552 651..492 800 100 Minus
3L 28110227 3L 10221076..10221132 707..651 285 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:09:42 has no hits.

FMO10068.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:15 Download gff for FMO10068.5prime
Subject Subject Range Query Range Percent Splice Strand
scramb1-RC 342..1047 1..707 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:54:36 Download gff for FMO10068.5prime
Subject Subject Range Query Range Percent Splice Strand
scramb1-RA 760..1458 9..707 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:50:47 Download gff for FMO10068.5prime
Subject Subject Range Query Range Percent Splice Strand
scramb1-RA 760..1458 9..707 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:50:47 Download gff for FMO10068.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 10221611..10222093 9..491 100   Minus
3L 10221394..10221552 492..650 100 <- Minus
3L 10221076..10221132 651..707 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:54:36 Download gff for FMO10068.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 10214711..10215193 9..491 100   Minus
arm_3L 10214494..10214652 492..650 100 <- Minus
arm_3L 10214176..10214232 651..707 100 <- Minus