Clone FMO10069 Report

Search the DGRC for FMO10069

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:69
Vector:pMK33-CFH-BD
Associated Gene/Transcriptcbt-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10069.5prime Sequence

1157 bp (1037 high quality bases) assembled on 2010-10-30

> FMO10069.5prime
CAGTCGACATGGACATGGATACCTTGCTACCTTCACCACCCGCAACGCCC
CCACTAAGGGAAAACAAGTTGGAAATCGTCGCCAAGGACGAACAACAGGT
GAACGAGAATCTGCTAAAGGCAAAGCTCAAGCTGGTGGCCCAAAAGAGTC
AGAAAAATGGAGGGATTATTACACCAAATCCATCGGACACGGAAGACGAG
GCTCCCGAAATAGCGGTTCCCAACAAGAAACCCCGTTTGGAACAACCTGC
TATGAGCATGACACCGCCGCCGGATCAAAAGCTGGACGATGATCAGAAAG
CGGAAAGGGTTAGCGTCATCATGCGGGTCAACAGTTCTGGCGCTGTCTCT
TCTAGTAGCCAAGACGAGAACTCATCTAGTTCCACCTCCTGCTGTAGTTC
CTCTTCCAACACAAACACAAGTACAAGTTCAGTACCACCCACTGTGGAGG
ACGACTATCCAGAGGCCAATGTGTGGCGCAATCTCAAGTTCAAAATGAAC
AGAAAGCGTGCTGCAGAAGTGGCACTACCCCCAGTACAAACACCCGAGAC
ACCAGTTGCGAAGCTTGTAACGCCACCTGCTCCAGCGGAATGCATCAAGG
AGGAGGAAATAAAACCTATTCTGACACCGATATATGTTAGCCCAGTAGCT
TCGTCTGCCAGCCAACTTATCCTGCTCAGCACAGTGGCCGCCCAACAGAG
CCCCACACCCGTACCCAAAACGCCAACAATGTCCGAGGAGAAACTAACAA
CCAGAATTACGGCCGCCCAGGCGGCGGCCACCAGAAGTCGCATCTACGAG
TGCAGTTTTCCCGATTGCGGCAAGAATTACTTCAAAAGCAGTCATCTGAA
GCCCACCAGAGGGTTCACACCGGCGAGCGACCCTTTATCTGCAAGTGGGA
GAACTGTGACAAACGATTCTCCCGTTCCGATGAGTTGTCCCGACACAACG
GACCCACACCGGTGAAAAGAATTCCAGTGCAGCGTCTGCCAGAAGAATTC
ATGAGAGCGATCCACTGTCGAGCACGTCAAACGGCACACAGACAGCGAAC
GGAGTGAATCGACATGTCTCCCTGGCACAACAACATCAGCTTCGGAGCGC
TTCCCTCTGCATGCTCGCTCCATTGGACGAATGACCGCATCAAGCTAGTT
TCCTGCC

FMO10069.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:09:47
Subject Length Description Subject Range Query Range Score Percent Strand
cbt-RA 2041 CG4427-RA 214..1348 9..1124 5210 98.1 Plus
cbt-RC 2361 CG4427-RC 603..1668 78..1124 4865 98 Plus
cbt-RB 3243 CG4427-RB 1485..2550 78..1124 4865 98 Plus
cbt-RC 2361 CG4427-RC 214..284 9..79 355 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:09:45
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 477195..478204 1076..78 4550 98.3 Minus
2L 23513712 2L 479405..479475 79..9 355 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:09:46 has no hits.

FMO10069.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:16 Download gff for FMO10069.5prime
Subject Subject Range Query Range Percent Splice Strand
cbt-RA 201..1347 1..1130 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:54:38 Download gff for FMO10069.5prime
Subject Subject Range Query Range Percent Splice Strand
cbt-RA 207..1353 1..1130 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:50:49 Download gff for FMO10069.5prime
Subject Subject Range Query Range Percent Splice Strand
cbt-RA 207..1353 1..1130 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:50:49 Download gff for FMO10069.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 479407..479481 1..77 94   Minus
2L 477134..478204 78..1130 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:54:38 Download gff for FMO10069.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 479407..479481 1..77 94   Minus
arm_2L 477134..478204 78..1130 97 <- Minus