Clone FMO10070 Report

Search the DGRC for FMO10070

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:70
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG1648-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10070.5prime Sequence

722 bp (722 high quality bases) assembled on 2010-10-30

> FMO10070.5prime
CAGTCGACATGTTTCCTAGTCGCCAAAACCAAACTTCCTTGAAGAACTTC
GGTGACAAGACCGCCAACCTCTTCAGCAAGAAGAAGGATGAGGCCGAGAA
GCTGGCCAACGAGAAGGCTGCCGAGGCCCAGAAGCTAGCCGAGGAGCAGG
CCAAGAAGGTGGGCCAGTCCGTACAGCAGACCAAGGGCGAGGCCGAGCAG
TTGGCCGCCAGCACGGCCAAGGAAGCCGCTGCTCTAGCCACCGCGGAGGC
TCAGAAGGCTGGACAGGCGATTGACCAGGGTGTGAACCGTGCCGCCGGAG
CCGTCAACCAAGGCAAGCAGGCGGTGGACAACACGGTGGCCCAGGCGGCG
GCCGTGGCCCAGAACTCCAAGCAGGTGGCGGCCAATGTGGCGGAGGCCTC
CCAGCGAGCGGCCGCCAATGCGGTGGACCAGACCAAGAAGGCGGCCAACG
ACGCCATCAACAAGAGCGTGAAGGCCGCCGAGAACGTGGCGGACCAGAAG
CTGAAGCAGGCGGAGGGCGCCATCGATGGGGCACTGAAGCAGACCAGTCA
AACGGTGGACCAGAAGCTGCAGGAGGCCAACCAGTATGTCGACCAGAAGC
GCCAGTCCGTCGAGAAGACCGTCCAGGATGCGGCAGGACAGGCCCAGGAG
TCTGCCGGACAGCAGGCCAACGCCCTGTTGGGCAAGCTGCATCTGGGTCA
GAAGGCAAGCTTTCTAGACCAT

FMO10070.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:13:38
Subject Length Description Subject Range Query Range Score Percent Strand
CG1648-RB 884 CG1648-RB 19..722 1..704 3460 99.4 Plus
CG1648-RC 1392 CG1648-RC 215..885 34..704 3325 99.7 Plus
CG1648-RA 1047 CG1648-RA 215..885 34..704 3325 99.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:13:35
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 9811481..9811969 704..216 2415 99.6 Minus
2R 25286936 2R 9812482..9812664 216..34 915 100 Minus
Blast to na_te.dros performed 2014-11-26 15:13:36
Subject Length Description Subject Range Query Range Score Percent Strand
Dbuz\Osvaldo 9045 Dbuz\Osvaldo DBU133521 9045bp Derived from AJ133521 (Rel. 60, Last updated, Version 2). 2933..2997 477..541 109 63.1 Plus

FMO10070.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:52 Download gff for FMO10070.5prime
Subject Subject Range Query Range Percent Splice Strand
CG1648-RB 19..722 1..704 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:28 Download gff for FMO10070.5prime
Subject Subject Range Query Range Percent Splice Strand
CG1648-RB 19..722 1..704 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:33 Download gff for FMO10070.5prime
Subject Subject Range Query Range Percent Splice Strand
CG1648-RB 19..722 1..704 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:33 Download gff for FMO10070.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 9812724..9812756 1..33 94   Minus
2R 9812482..9812664 34..216 100 <- Minus
2R 9811481..9811968 217..704 99 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:28 Download gff for FMO10070.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 5700229..5700261 1..33 94   Minus
arm_2R 5699987..5700169 34..216 100 <- Minus
arm_2R 5698986..5699473 217..704 99 <- Minus