Clone FMO10071 Report

Search the DGRC for FMO10071

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:71
Vector:pMK33-CFH-BD
Associated Gene/TranscriptTwdlC-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10071.5prime Sequence

1094 bp (997 high quality bases) assembled on 2010-10-30

> FMO10071.5prime
CAGTCGACATGCGTGTCTCCTCGCTGTTCGTTGTGTGCGTGGCCTCCCTG
GTGGCCACCACTTTGGGTCGTCCTGAGCCCCCATCCCCGTACTCCTACCA
CGGATTGCCTCAGCAGCAGAGCCAGCGGGCTTTGCCACTCAATGCTCACC
CCGTTCCCCCGCAGATTTACCAGCCTCTGCCCCAGGAGCAGTCGTTTGCC
AACTTTGCACCGCCCCAGCAGACCTACTTGCCACCCCAAATGCATCTGGA
TGCCATCGAGCAAGTGGCTCCCACTGCCGCCGCCGCTGAGCCCCTGAATG
CCTACGATGACAGCTACAACATGGCCCACCGCCTGTCCGGAGTGCAGCAT
GCCAGTGGCTACAACAATGGCCCCCAGGAGACCAAGGTGCACAAGCACAT
CTACGTCCATGTGCCGCCAAAGGACTTCGAGGAGGAGGATGCCATCCAGA
CCCGAGTTCACCACCAGCAGGGACCCAAGCAGAAGCACTACAAGATCGTG
TTCATCAAGGCACCATCTGCTCCGGCTATCCGTCAGCCAGTTGTGCCACC
ACCACCCCAGAATGAGGAGAAGACTCTGATCTATGTGCTGCACAAGAAGC
CCGAGCAGGAGCAAGATATCGTGATCCCGACGCCACCACCCACCAAGCCA
TCGAAGCCAGAGGTTTACTTCATCAAGTACAAGACCAAGAAGGACGAGGC
CCCCGTCTATGGACCCCCACCTGCAGAGATGGAGCCCCGTCAGGCCACCG
CCGAGGATTTCGCTCCATTGGCTGAGGTCGCCGATGTCCTGCCACCCACC
ACCCTGGCTCCTGCTCCCGAGCCGGAAGTAGAGCAGCCAGCCATTCCCTC
CGCGGTCTACGGACCACCCACTGCAGCTGCCTATACTGGTGAGGAGGTTC
AGACCACCTTGTCCGCTCCTGCCACAGTATTCTGCCCCCTGCACCGCTCC
CGCCGCCCTGGGCATTGAGGAGCCCTCATGGGGACCCATCGTGGTGGAAG
AAAAACCCGAGACACGACATGGGTCCTTCCCTGAGCTGCCACCAGCTAAG
GTCCTCCTCAACCCATTATTCCCTTAGAAGCTGGACGCAGGATT

FMO10071.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:13:42
Subject Length Description Subject Range Query Range Score Percent Strand
TwdlC-RA 1396 CG14254-RA 103..1179 9..1083 4910 97.6 Plus
TwdlT-RA 1607 CG5812-RA 665..879 480..694 385 79.7 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:13:39
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 26995284..26996153 144..1011 4070 98.6 Plus
3R 32079331 3R 26994934..26995069 9..144 680 100 Plus
3R 32079331 3R 27050140..27050276 558..694 370 84.7 Plus
Blast to na_te.dros performed on 2014-11-26 15:13:41 has no hits.

FMO10071.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:53 Download gff for FMO10071.5prime
Subject Subject Range Query Range Percent Splice Strand
TwdlC-RA 92..1164 1..1072 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:29 Download gff for FMO10071.5prime
Subject Subject Range Query Range Percent Splice Strand
TwdlC-RA 96..1168 1..1072 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:34 Download gff for FMO10071.5prime
Subject Subject Range Query Range Percent Splice Strand
TwdlC-RA 96..1168 1..1072 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:34 Download gff for FMO10071.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 26995285..26996214 145..1072 97   Plus
3R 26994927..26995069 1..144 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:29 Download gff for FMO10071.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 22821007..22821936 145..1072 97   Plus
arm_3R 22820649..22820791 1..144 97 -> Plus