Clone FMO10072 Report

Search the DGRC for FMO10072

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:72
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG14990-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10072.5prime Sequence

1046 bp (985 high quality bases) assembled on 2010-10-30

> FMO10072.5prime
CAGTCGACATGCTCAAGAACTGGACAATAAATACGTTCCTTTTGGTTTCG
TTTCTTTGTAGTGCGACTGGGCAAAATGAAGGAGGAGCACCTGGAATATT
CAACGGAATGTCATTCACGGAAAATCTTCAACCAGACCCAAATCAAGTTT
GCGGCATGAGCAATCCAAATGGCTTGGTGGCCAATGTGAAGGTGCCCAAA
GATTACTCCACACCTGGCCAATTTCCATGGGTGGTTGCCCTTTTCAGTCA
GGGAAAATACTTTGGGGCCGGTTCTTTGATTGCCCCAGAAGTAGTCCTTA
CAGCGGCTAGCATTGTGGTGGGCAAGACTGATGCGGAAATTGTGGTGAGA
GCAGGCGAATGGAATACGGGACAACGCAGTGAATTCCTACCGTCGGAGGA
TCGTCCGGTGGCCAGAGTTGTGCAACACAGGGAGTTTTCGTATTTATTGG
GAGCCAATAACATTGCCCTTCTGTTCCTAGCCAACCCATTTGAGTTGAAA
AGCCACATCCGAACCATCTGCTTGCCCAGCCAGGGAAGGTCCTTCGATCA
GAAGCGCTGCTTGGTGACCGGATGGGGAAAGGTGGCATTCAACGATGAAA
ATTACTCAAATATCCAAAAGAAAATCGAACTGCCGATGATTAACAGGGCG
CAGTGCCAGGATCAGTTGAGAAACACCAGATTGGGCGTCTCGTTTGATCT
GCCTGCTAGTCTGATATGCGCCGGCGGCGAGAAGGATGCGGGAGACTGCC
TCGGCGACGGAGGATCCGCTCTATTCTGCCCCATGGAGGCGGACCCATCG
CGCTATGAGCATCTGGCATCGTTAACTGGGGCATCGGCTGTCAAGAGGAA
AACGTTCCAGCAGTCTACACAAATGTTGAAATGTTTCGGGATTGGATCTA
TGAGCACATGGCCCAGAACTCCACAGTGTTCATTCGCTGCTGGTCAGTTA
CATCGAACTATAAACAGGAAGCCAGCTTTCTAGAACCATTCGTTTGGCGC
CCCGGGCCCAGGTTAGTGGTCCAAATTATAATCCAAATCCTATTCA

FMO10072.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:13:47
Subject Length Description Subject Range Query Range Score Percent Strand
CG14990-RA 1072 CG14990-RA 32..998 8..970 4720 99.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:13:44
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 4093383..4094270 87..970 4225 99.4 Plus
3L 28110227 3L 4093238..4093317 8..87 400 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:13:46 has no hits.

FMO10072.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:53 Download gff for FMO10072.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14990-RA 28..1009 1..982 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:31 Download gff for FMO10072.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14990-RA 27..1008 1..982 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:35 Download gff for FMO10072.5prime
Subject Subject Range Query Range Percent Splice Strand
CG14990-RA 27..1008 1..982 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:35 Download gff for FMO10072.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 4093383..4094282 87..980 98 -> Plus
3L 4093233..4093316 1..86 95 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:31 Download gff for FMO10072.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 4093383..4094282 87..980 98 -> Plus
arm_3L 4093233..4093316 1..86 95 -> Plus