Clone FMO10074 Report

Search the DGRC for FMO10074

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:74
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG32544-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10074.5prime Sequence

584 bp (584 high quality bases) assembled on 2010-10-30

> FMO10074.5prime
CAGTCGACATGTCGTCGGAGCAGCCGGAGAACACCAGCTACGAGCAGGAA
TGCCAACGGGCGGAGCTGCTGGGCCTCCAGCCACCGGATCCCGCGGAGTT
CGAGCGCAAACGGCAGGCACGACTGGAGCACGAGTTGGCCGAGCAAGAGG
CCGCCGAGGCGGTGCTGCTGGAGCAACAAGACGAGAGTCTGGGCAATGTG
GGCGGCAAGCTGGGCGAGCTCAATAGCATCCTGTCCAGCACGCAGCAGAA
GCTGAATCGCTTCAAGCAAACGGCATGTGGCAGTTTGACCAACATATTTG
CCCGGGCCAGCTCGGGCTCGGTGGATCTTTCGGCGGGCATTGGTAGATCG
GGCTCAATCGCCTCCACACAGGAGGAGCGTCCTCCTGTCCAGGAACAGCC
ACTGGCCAAGCCTCCGCCGACGGCTGCCGAGGTCAGCGCCGCCAAGGCGG
CCAAGCAGAAGCGCATGGACTCGCAGCTGGACAAGCTGGATGCGCTGATC
AACCAGGCGGACAACGCTCAGATAGCCATGAGTGAGCAGACACAGCAGAT
GCGCCGCCTGGCCAAGGCAAGCTTTCTAGACCAT

FMO10074.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:10:04
Subject Length Description Subject Range Query Range Score Percent Strand
CG32544-RB 1527 CG32544-RB 30..588 8..566 2780 99.8 Plus
CG32544-RA 1630 CG32544-RA 30..588 8..566 2780 99.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:10:01
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 18860520..18860922 164..566 2000 99.8 Plus
X 23542271 X 18860313..18860469 8..164 785 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:10:02 has no hits.

FMO10074.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:18 Download gff for FMO10074.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32544-RA 24..593 1..571 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:54:46 Download gff for FMO10074.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32544-RA 24..593 1..571 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:50:54 Download gff for FMO10074.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32544-RA 24..593 1..571 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:50:54 Download gff for FMO10074.5prime
Subject Subject Range Query Range Percent Splice Strand
X 18860521..18860927 165..571 99   Plus
X 18860307..18860469 1..164 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:54:46 Download gff for FMO10074.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 18754554..18754960 165..571 99   Plus
arm_X 18754340..18754502 1..164 97 -> Plus