Clone FMO10075 Report

Search the DGRC for FMO10075

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:75
Vector:pMK33-CFH-BD
Associated Gene/Transcriptmthl5-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10075.5prime Sequence

1145 bp (1048 high quality bases) assembled on 2010-10-30

> FMO10075.5prime
CAGTCGACATGCTCGTAAAAACGCTTGGCGCGCATTTTGCAGCCGGGCAA
AATGCAAAAAAATGCAGCTGCTGCGCTCTGCTGATTTCCCTGCTCTGCGT
ATTACTTCTTAGTCTAAACCCTTTACCAGTAACCAGTCATGTCACTAGCG
CCGGATCATCAACAGCCCTATCTTCCGATCCCAACCTAGTGCTGGTCAAC
AAATGTTGCGAGAAGTTCGAGATACACGTGGACCATGAGTGTCAGCAGGT
CAATGAAACGGACTACTTCCAGCCGATGTTCACCAGCTATGGAGGAGAGC
AAAACAGGCCCGTTAAGTTCAAATTCGTCATCGGGATTCCAAATTGTGGA
TCCATGCAGATGTGGCCAATATACCACTATGCTGGCAGCTCTGATAAGCT
AGTGTTACTGGATGATGGGAGGCTAAGGCATTACACCAATGCCGAAAACG
AAGCAGAGGAGCGTCATGGAATACAATCGGATTATGAGGAGGATATTGCC
GGCAGTCTGGAACCGCTATACCATGACTACGATAAGGGATTGTATTGCAT
TGACAAGGCCACTTCCAGTACTGGAGAGGAAAATGTGCTATTCGCCAACA
TTTGCTTGGCCCGCAAGGAGATCAAGTGGAGTGACTCAAACTTTCTGCTC
CGCAAAATCTTAAACCCAATTTTCCATGGCATCTCGCTTGTTATCCTGCT
GGTCATCGCCATCATCTATTTTATACTTCCTACTCTCAGAGATCTGGTTG
GTAACATTGTGACAACGATAGCCATGTGCCTTATGGTAAGCCAGGCAGCA
GACCTTGTCAGAATTTTCACCGAGCTGACCAGCCATGTGAGCTTCATTGT
GGCGGACATTATCCTGTGCTTCAGCCTCTTGGCAGCTTTCTTCTGGCTGA
CAGTTTCGGTTTTACATTTGGAGACCTTTCGTTCGAGGAACGTCTTCCTG
CGAGTCACGGACGGCAAGAAGTACTGCTATTATTCTGCGTATGCTTGGGA
TGCACAGCACGATGGCTGCACTGGCTGTTTTTCGCACATTTCTTCTCGAC
GCGGATCTACAAACAGGAGCACATGGTGGGCCGAGACAAGAGACGAATCG
GCTGGCTAGGCCATATGCCTATTCCTTGCTCATGCCTTGTACATT

FMO10075.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:10:08
Subject Length Description Subject Range Query Range Score Percent Strand
mthl5-RA 1949 CG6965-RA 334..1459 9..1131 5255 98.4 Plus
mthl5-RB 1952 CG6965-RB 334..1462 9..1131 5215 98.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:10:05
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 11884489..11884886 1131..737 1310 95.3 Minus
3R 32079331 3R 11886583..11886835 261..9 1265 100 Minus
3R 32079331 3R 11884942..11885125 739..556 920 100 Minus
3R 32079331 3R 11885180..11885351 558..387 860 100 Minus
3R 32079331 3R 11885415..11885540 386..261 630 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:10:06 has no hits.

FMO10075.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:19 Download gff for FMO10075.5prime
Subject Subject Range Query Range Percent Splice Strand
mthl5-RA 331..1456 9..1131 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:54:48 Download gff for FMO10075.5prime
Subject Subject Range Query Range Percent Splice Strand
mthl5-RA 334..1459 9..1131 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:50:56 Download gff for FMO10075.5prime
Subject Subject Range Query Range Percent Splice Strand
mthl5-RA 334..1459 9..1131 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:50:56 Download gff for FMO10075.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 11886583..11886835 9..261 100   Minus
3R 11885415..11885539 262..386 100 <- Minus
3R 11885181..11885351 387..557 100 <- Minus
3R 11884942..11885123 558..739 100 <- Minus
3R 11884472..11884883 740..1145 94 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:54:48 Download gff for FMO10075.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 7712305..7712557 9..261 100   Minus
arm_3R 7711137..7711261 262..386 100 <- Minus
arm_3R 7710903..7711073 387..557 100 <- Minus
arm_3R 7710664..7710845 558..739 100 <- Minus
arm_3R 7710194..7710605 740..1145 94 <- Minus