Clone FMO10078 Report

Search the DGRC for FMO10078

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:78
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG5946-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10078.5prime Sequence

970 bp (970 high quality bases) assembled on 2010-10-30

> FMO10078.5prime
CAGTCGACATGGCCCGCATCGTTGAAAGCAATTTTGTGCCACTCGCCGTG
GGTGTGGTAGCCGTACTCGCCGGCGCCCTGATCGTCCACTATCTGCTGAA
TAAGAAGTCCACGAAACCACGCCGGGAACCCAATCGCACCGCTCGGCTGC
GCACACTTGTGGATCCCAATGACAAGTACCTGCTGCCTCTCATCGAAAAG
GAGAATCTGAGCCATGACACTAGGAGATTCCGGTTTGGATTGCCCTCCAA
GCAGCATGTCCTTGGCCTGCCCGTTGGCCAGCACATTCATCTGATCGCCA
CCATCGACAATGAGCTAATAATTCGGCCATACACTCCGATATCGTCTGAT
GAGGATGTGGGCTACGTGGACCTAGTCGTCAAGGTGTACTTCAAGGATTC
GCATCCCAAGTTCCCGGCCGGCGGCAAAATGACACAACACCTGGAGCAGC
TCGAGTTGGGGGACAAGATCTCGTTCCGTGGTCCCTCGGGTAGGCTACAA
TATCTCGGCAATGGCACCTTCTCCATCAAAAAGTTGCGCAAGGATCCTCC
AAAGCACGTGACCGCCAAGCGGGTCAACATGATTGCCGGCGGCACTGGCA
TTACTCCAATGCTTCAATTGGCCAGGGAAGTTCTCAAGCGCAGCGATAAG
GATAAGACTGAACTGGCGTTGCTGTTCGCCAATCAGAGCGAAAAGGACAT
TCTACTGCGTGCAGAGTTGGACGAACTGGCCCAGAAGCATCCTGACCAGT
TCAAGATCTGGTACACAGTCGACAAGGCAAACGAAGGTTGGCAGTATAGC
GTTGGCTTCATCAATGAGGAAATGATCGCCGCCCACCTGCTTCCGGCCAA
GGACGATACCATTGTGTTGCTTTGCGGCCCACCACCCATGATTACTTTGC
CTGCATCCGGCGCTGGACAGCTTGGCTACCATCCGGACACCCGTTTGCCT
ACGCAAGCTTTCTAGACCAT

FMO10078.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:10:15
Subject Length Description Subject Range Query Range Score Percent Strand
CG5946-RF 1460 CG5946-RF 348..1296 8..952 4630 99.5 Plus
CG5946-RB 1686 CG5946-RB 286..1234 8..952 4630 99.5 Plus
CG5946-RA 1224 CG5946-RA 135..1060 31..952 4515 99.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:10:13
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 11818254..11818907 686..33 3270 100 Minus
3L 28110227 3L 11817154..11817318 946..785 660 97.6 Minus
3L 28110227 3L 11818086..11818189 788..685 520 100 Minus
Blast to na_te.dros performed on 2014-11-26 15:10:14 has no hits.

FMO10078.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:20 Download gff for FMO10078.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5946-RB 261..1219 1..956 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:54:53 Download gff for FMO10078.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5946-RB 279..1237 1..956 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:50:59 Download gff for FMO10078.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5946-RB 279..1237 1..956 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:50:59 Download gff for FMO10078.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 11818254..11818907 33..686 100 <- Minus
3L 11818088..11818187 687..786 100 <- Minus
3L 11817144..11817316 787..956 95 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:54:53 Download gff for FMO10078.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 11811354..11812007 33..686 100 <- Minus
arm_3L 11811188..11811287 687..786 100 <- Minus
arm_3L 11810244..11810416 787..956 95 <- Minus