Clone FMO10080 Report

Search the DGRC for FMO10080

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:80
Vector:pMK33-CFH-BD
Associated Gene/TranscriptSpn77Bb-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10080.5prime Sequence

1139 bp (1036 high quality bases) assembled on 2010-10-30

> FMO10080.5prime
CAGTCGACATGAAGCTCGGATTTCTGGGGCTTTTTGGCATGGTGCTCATG
ATCATGTTCTACGAGGGAGCAGAAGGGTATACCGTCAATGAGCTGCGCGA
TGTCCTGGGGATCTATGTCGATTATCCAACACTGCGCAGGTGGTACGAGG
ATGTCCGAGCTTATCACTATTTAAATTCGGAAAACACAAAACTGTTTTCG
CTGCGTTACGCTTACTACGACGACGTAGGAGATTTAGAACTCGTGAAAGG
GTACAACAGTGTAGTCCTAGAAGGAGTAGGAGAAGGAAATGTGGTTCTTC
GAGAGGGTCGGCCAAGGGGTGTGGACTTCGACCAGGGGGCGAGTATAATA
ATCAACGACGATATCGACAAAGCCTCTCATGCGAAAATCTTCAGTTCTTA
TAGCCGTCGTTCGTTCAATAGTACAGTAACTGTGCTGGGGATTACTGTTA
GCTACTTTAAGGCCAAATGGAAGTATCCATTCGATAAGTCCCAGACGAAA
GTGGAACAGTTTTACAACGACGGCGGCTCGCCGGCAGGTAAGGTGGAGAT
GATGGTGCAAACGGGGAAGTATGCCTACGTCAATAATGTAAAGGGTCTGC
AAGCGGATGTCCTGGAGCTACCTTTTGGGGAACATGAGCTAGTAATGATC
GTCTTACTGCCGAAGTCATCCCAGGGAGTTAACCTGGTGCTCTACCAATT
GAAGAACCTGGGACTACATCGCCTCCTTGAGAAACTCGAGGCCTCCAAGA
ATGAAACTGATGTAGAAGTCAAGCTTCCCAAGTTCGATACGCGATCCGTA
CTTTCACTCGAAGATACCGTATATGACGCTGGACTAACGGATCTGAGGAC
GACTTCGCAGATCTAGATAAATTGCTGATTGCTATCGGTCACAGAGGTGC
GTGCCTCACCCTCTACCACCAATTCGCAGGATCGTCGTAGATGAGAGGGT
TTGCCTAATGCTGTTCGCAGAAGTCTTCTGGAAAAAATAACATCAAGTTC
ATGTAAACAGTCGTTGCATACCTTGTCTACAAAAGAAACACAATGCTCAT
CCCTCGGAATCTTCCTGAGGGGAGATCCAGCAGCTTTCTAGAACATCGTG
GCCGCGGCCAGTATGCTATCTAATCTAATCTATCTATCC

FMO10080.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:10:18
Subject Length Description Subject Range Query Range Score Percent Strand
Spn77Bb-RA 1161 CG6663-RA 35..1120 9..1080 5010 98.2 Plus
Spn77Bc-RB 1430 CG6289-RB 241..1287 48..1080 4125 93.8 Plus
Spn77Bc-RA 1440 CG6289-RA 251..1297 48..1080 4125 93.8 Plus
Spn77Bc-RB 1430 CG6289-RB 40..79 9..48 185 97.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:10:16
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 20321638..20321994 472..828 1785 100 Plus
3L 28110227 3L 20343497..20343851 472..826 1610 96.9 Plus
3L 28110227 3L 20321269..20321572 170..473 1520 100 Plus
3L 28110227 3L 20343128..20343431 170..473 1490 99.3 Plus
3L 28110227 3L 20321041..20321201 9..169 805 100 Plus
3L 28110227 3L 20322051..20322274 828..1043 725 95.5 Plus
3L 28110227 3L 20342939..20343060 48..169 445 91 Plus
3L 28110227 3L 20343910..20344086 828..1000 430 88.1 Plus
3L 28110227 3L 20342738..20342777 9..48 185 97.5 Plus
Blast to na_te.dros performed on 2014-11-26 15:10:17 has no hits.

FMO10080.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:21 Download gff for FMO10080.5prime
Subject Subject Range Query Range Percent Splice Strand
CG6663-RA 25..1086 9..1058 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:54:56 Download gff for FMO10080.5prime
Subject Subject Range Query Range Percent Splice Strand
Spn77Bb-RA 35..1096 9..1058 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:00 Download gff for FMO10080.5prime
Subject Subject Range Query Range Percent Splice Strand
Spn77Bb-RA 35..1096 9..1058 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:00 Download gff for FMO10080.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 20322051..20322291 828..1056 94 -> Plus
3L 20321640..20321993 474..827 100 -> Plus
3L 20321269..20321572 170..473 100 -> Plus
3L 20321041..20321201 9..169 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:54:56 Download gff for FMO10080.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 20315151..20315391 828..1056 94 -> Plus
arm_3L 20314740..20315093 474..827 100 -> Plus
arm_3L 20314369..20314672 170..473 100 -> Plus
arm_3L 20314141..20314301 9..169 100 -> Plus