Clone FMO10081 Report

Search the DGRC for FMO10081

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:81
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG4653-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10081.5prime Sequence

788 bp (788 high quality bases) assembled on 2010-10-30

> FMO10081.5prime
CAGTCGACATGAGTCCGGTTCAGTCATATTCACACAGTCGACTACTCCTG
CTCGTGGTCATCGTGACCTTGGGCGTGGTCCAATCCAGTCGACTGCCGGC
GGAGGTGGGCTCCCAGCCACACAGCATCTCACTGCGTCGGAATGGCGTCC
ATGTGTGCGGAGGAGCTTTGATCCGTGAAAAGTGGATCCTCACCGCAGCC
CATTGCGTCAGTTTGGGCGGTGGACAGCAGAGCTACCCAGCTAAATCCTA
CAATGTGCGAGTGGGCAGCATTCAGCGACTGACCGGTGGTCAACTGGTGC
CTCTGTCCAAGATCATAATCCACACGAACTACTCCAGTTCGGATGCAGTT
GGCTCTAATGACTTGGCCTTGCTGGAGCTGGAAACGTCGGTGGTCCTGAA
TGCGAATACGAATCCGATTGATTTGGCCACCGAGCGACCGGCGGCGGGCT
CCCAGATTATCTTCTCCGGCTGGGGATCCAGCCAGGTGGACGGATCTCTC
AGTCATGTCCTCCAGGTGGCCACCAGACAGAGCCTGAGTGCGTCCGATTG
CCAAACGGAGCTGTACCTGCAGCAGGAGGATCTGCTCTGTTTGTCCCCGG
TGGACGAGGACTTCGCCGGACTCTGTTCCGGTGATGCCGGAGCTCCGGCG
TCTTACAACAACCAATTGGTGGGCATTGCCGCCTTCTTTGTGAGCGGATG
TGGTTCCGAGCAGCCCGATGGCTACGTGGATGTGACCCAGCATCTGGAGT
GGATTAACGAAAACGCTGTTGCAAGCTTTCTAGACCAT

FMO10081.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:10:23
Subject Length Description Subject Range Query Range Score Percent Strand
CG4653-RA 895 CG4653-RA 7..769 8..770 3815 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:10:21
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 16704613..16705152 231..770 2700 100 Plus
X 23542271 X 16704087..16704311 8..232 1125 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:10:22 has no hits.

FMO10081.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:21 Download gff for FMO10081.5prime
Subject Subject Range Query Range Percent Splice Strand
CG4653-RA 1..765 9..774 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:54:58 Download gff for FMO10081.5prime
Subject Subject Range Query Range Percent Splice Strand
CG4653-RA 2..772 5..774 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:01 Download gff for FMO10081.5prime
Subject Subject Range Query Range Percent Splice Strand
CG4653-RA 2..772 5..774 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:01 Download gff for FMO10081.5prime
Subject Subject Range Query Range Percent Splice Strand
X 16704615..16705155 233..774 99   Plus
X 16704080..16704311 1..232 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:54:58 Download gff for FMO10081.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 16598648..16599188 233..774 99   Plus
arm_X 16598113..16598344 1..232 98 -> Plus