Clone FMO10085 Report

Search the DGRC for FMO10085

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:85
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG8786-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10085.5prime Sequence

834 bp (834 high quality bases) assembled on 2010-10-30

> FMO10085.5prime
CAGTCGACATGTCGCAACAGCGCTCCACAGAGCAGATTGCAGCTAGCAAC
AACAACACCAGCGATGTAATAGCGCTGGACGACGACGAGGATACGGATGT
GCAATTCGTTGCAGCTCTGCGTCCCACCGCACCAGTCATCGATCTTTGCG
TCTCGCCCTCCACTTCTGCTGCTGCTGCTGCGGCGGCGGCAGCTGCAGCC
CACTCAGGAGGCGGAAGTGGCGAGGATCCGGCGGTTGGATCCGCATCTGG
AGCTGCTGCTTCGGATACCGATTCACTTGCTTCTTCGCCTGACGAAGGAG
CGTTAGCCACCGGTGTGGATGCAGCGGCAGCCGTTTCTGGCGAAGATTCC
CCCTCTGCAGCGGCCGCTGCCTTGGAGTGTCCCATCTGTTTGCAAACCTG
CATCCACCCAGCTCGTCTCCCCTGTGGCCACATCTTCTGCTTTTTGTGCG
TGAAGGGTGTTGCTTATAAGAACCGCCGTTGTGCTATGTGCCGTCGCGAG
ATTCCCGCCGAGTTCCTGGACCATCCCCAGCTGGTGAATGGCATTGAGGA
CATCTGCACCACTCGCGCGACCGAGGACGGCTTCCAGTGGTATTACGAGG
GAAGAAACGGTTGGTGGCAGTACGATGACCGCACTAGTCAGGACATCGAA
GATGCCTTTAAGAAGGGCGACAAATCCTGTACAATTTTGGTAGCCGGCTA
CGTCTACATTGTGGACTTGGAGCAGCTAGTCCAGCAGCGCCAGAATGAGC
CCACTCGCTGCCGGAGGGTTAAGCGAGACCTAGCCACCATACCCAAAAAG
GGGGTGGCGGTCTGCGGAATCGAAAGCAACCAGG

FMO10085.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:10:28
Subject Length Description Subject Range Query Range Score Percent Strand
CG8786-RG 3862 CG8786-RG 149..975 8..834 4075 99.6 Plus
CG8786-RC 1667 CG8786-RC 149..975 8..834 4075 99.6 Plus
CG8786-RB 1963 CG8786-RB 149..975 8..834 4075 99.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:10:25
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 19642352..19642668 324..8 1585 100 Minus
3L 28110227 3L 19640094..19640319 834..609 1020 98.7 Minus
3L 28110227 3L 19641063..19641220 611..454 790 100 Minus
3L 28110227 3L 19641893..19642026 456..323 670 100 Minus
Blast to na_te.dros performed 2014-11-26 15:10:26
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2305..2467 332..167 112 53 Minus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2767..2864 260..160 110 59.4 Minus
roo 9092 roo DM_ROO 9092bp 1061..1096 198..163 108 77.8 Minus

FMO10085.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:22 Download gff for FMO10085.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8786-RC 138..973 1..834 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:54:59 Download gff for FMO10085.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8786-RB 140..975 1..834 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:04 Download gff for FMO10085.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8786-RB 140..975 1..834 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:04 Download gff for FMO10085.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 19642352..19642677 1..324 99   Minus
3L 19641894..19642024 325..455 100 <- Minus
3L 19641065..19641218 456..609 100 <- Minus
3L 19640094..19640318 610..834 98 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:54:59 Download gff for FMO10085.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 19635452..19635777 1..324 99   Minus
arm_3L 19634994..19635124 325..455 100 <- Minus
arm_3L 19634165..19634318 456..609 100 <- Minus
arm_3L 19633194..19633418 610..834 98 <- Minus