Clone FMO10086 Report

Search the DGRC for FMO10086

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:86
Vector:pMK33-CFH-BD
Associated Gene/Transcript
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10086.5prime Sequence

1163 bp (1033 high quality bases) assembled on 2010-10-30

> FMO10086.5prime
CAGTCGACATGACCGTGACCGCCACACCGATGCCGGACAATCTGCGGGTG
AAAGCCTTATCCGAGTACCGAAAGAAGTTGCTAGAGCACAAGGAAATCGA
GGGACGCCTCAAAGAAAAGCGCGAGGAGATCAAGGATCTGACCAAGCTGT
ACGACAAGTCGGAGAACGATCTAAAGGCCCTGCAGAGCGTGGGACAGATC
GTTGGTGAGGTGCTGAAGCAGCTGACCGAGGATAAATTCATTGTGAAGGC
CACCAATGGACCCCGCTACGTGGTCGGCTGCCGCCGGCAGCTGGACAAAG
CCAAGCTGAAGTCCGGAACTCGTGTGGCCCTCGACATGACCACACTGACC
ATTATGCGCTACTTGCCGCGCGAGGTGGACCCACTGGTGTACAATATGTC
GCACGAGGATCCCGGGGATGTCACCTACTCGGCCATCGGCGGCCTAACCG
ACCAAATTCGCGAGCTGCGCGAAGTGATCGAGCTGCCCCTACTGAATCCG
GAGCTCTTCCTGCGCGTCGGCATCACGCCACCGAAGGGTTGTTTGCTGTA
CGGACCTCCTGGCACCGGCAAGACCCTGCTGGCCCGTGCAGTGGCCTCCC
AGCTGGACGCCAACTTCCTCAAGGTCGTGTCCTCGGCGATTGTCGACAAG
TATATTGGCGAGAGTGCGCGTCTCATTCGCGAGATGTTCAACTATGCCCG
CGACCATCAGCCCTGCATCATTTTCATGGACGAAATCGACGCTATCGGTG
GTCGGCGCTTCTCCGAGGGCACCTCTGCCGATCGCGAGATCCAGCGCACC
CTGATGGAGCTGCTCAACCAGATGGACGGCTTCGATTCGCTTGGCCCAAG
TCAAGATGATCATGGCAACCAATCGTCCGGACACCCTCGATCCTGCCCTT
CTGCGTCCGGGTCGCTTGGACAGGAAGATCGAGATTCCGCTGCCCAACGA
GCAGGCTAGTTGGAAATTCTCAGGATTCACGCACTGAAGATCGCCAAGCA
CGGCGAAATCGACTACGAGCCATTGTCAAGCTGTCGACACCTTTAATGGC
GCCTGATCTGCCGTATTGTCTGCACGAGGCGGGTCTCCTTGGCATTCTTG
GCGGGAGCGGGAGTTACCGCTCATTCCAGAAGAACTTTTGAGGCAGAGTG
CCTAAGGGTTCAG

FMO10086.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:10:32
Subject Length Description Subject Range Query Range Score Percent Strand
Rpt4-RB 1465 CG3455-RB 123..1227 9..1114 5235 98.6 Plus
Rpt4R-RB 1502 CG7257-RB 336..1169 149..982 1530 79.2 Plus
Rpt4R-RA 1391 CG7257-RA 225..1058 149..982 1530 79.2 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:10:29
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 6290055..6290775 959..238 3560 99.9 Minus
3L 28110227 3L 11942247..11942724 149..626 785 77.6 Plus
3L 28110227 3L 11942791..11943119 621..950 730 82.1 Plus
X 23542271 X 6290839..6290958 237..118 600 100 Minus
X 23542271 X 6291015..6291123 117..9 545 100 Minus
X 23542271 X 6289786..6289925 1097..959 385 93 Minus
X 23542271 X 11126270..11126437 777..945 240 77.5 Plus
Blast to na_te.dros performed on 2014-11-26 15:10:31 has no hits.

FMO10086.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:22 Download gff for FMO10086.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpt4-RA 121..1227 9..1117 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:55:01 Download gff for FMO10086.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpt4-RB 123..1229 9..1117 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:51:05 Download gff for FMO10086.5prime
Subject Subject Range Query Range Percent Splice Strand
Rpt4-RB 123..1229 9..1117 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:51:05 Download gff for FMO10086.5prime
Subject Subject Range Query Range Percent Splice Strand
X 6291015..6291123 9..117 100   Minus
X 6290839..6290958 118..237 100 <- Minus
X 6290055..6290775 238..959 99 <- Minus
X 6289784..6289925 960..1101 91 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:55:01 Download gff for FMO10086.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 6185048..6185156 9..117 100   Minus
arm_X 6184872..6184991 118..237 100 <- Minus
arm_X 6184088..6184808 238..959 99 <- Minus
arm_X 6183817..6183958 960..1101 91 <- Minus