Clone FMO10090 Report

Search the DGRC for FMO10090

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:90
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG5028-RC
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10090.5prime Sequence

1093 bp (1001 high quality bases) assembled on 2010-10-30

> FMO10090.5prime
CAGTCGACATGGCCCTTCGCTTGACCCAGAGATTGCTGCAGACGCAGACG
CCGTTCCTCACTCGCGGCTATCCCTTGCTGGTGACCAAGGAGAAGACCGA
GGATGTGGCCCACACCAAATCGGCGCTGCAGAAGAAAGTCACGGGCACCG
ATATTCCCTCGGCACAGTACGGAGGTCGTCATGCCGTCACCATGCTGCCG
GGCGGCGGCATTGGTCCTGAACTGATGGGCTATGTGCGCGAGATCTTCCG
GTATTGCGGTGCACCCATCGATTTCGAGGTGATCGACATCGATCCCTCCA
CCGAGGGCAACGATGATCTGGACTATGCCATCACATCGATTAAGAGGAAC
GGAGTGGCACTCAAGGGCAACATCGAGACCAAGTCCCAATCCTTGACCGA
AGTCTCCCGCAACGTGGCCATCCGTAACGAGCTGGATCTGTACGTCAATG
TGGTGCACTGCAAGTCGTATCCGGGCATTCCGGCCCGCCATCACGACATT
GACGTGGTGCTCATCCGCCAAAACACCGATGGCGAGTACGCCATGTTGGA
ACATGAGTCTGTGCCCGGAATTGTGGAGAGCATGAAAGTGGTGACCGTCG
AGAATGCCGAGCGTGTGGCCCGCTACGCCTTTGAGTTCGCCCGCCAAAAC
AATCGCAAGAAGGTTACCACCATTCACAAGGCCAACATCATGAAGCTGTC
CGATGGTCTCTTCCTGGAGGTTGCCAACCGTGTGCACAAGGACTATCCCG
AACTGGAGCACAACAACATGATTATCGACACACCTGCATGCAGTCCGTGT
CGAATCCTCACCAGTTCGACGTGATGAACATGACCAATCTGTACGGCACC
ATCGTGTCCAATGTTCTTTGCGGTTTGATGGGCGGAGCTGGCCTCATATC
CGGCAGGAACTACGATGACCATTACGCCATCTTTGACCCTGGCACCCGTA
ACACCCGGACCGCCATTGCCGGCCAGAATACCGCCAACCCTGTGGCCATG
ATCAGTGCCATATCGGATATGTTGAACATCTGGTCACAGGAGAACGCCAT
GTACATTCAGAGGCGTCTCAACATTGTCACATGCCCTTCCACG

FMO10090.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:14:00
Subject Length Description Subject Range Query Range Score Percent Strand
CG5028-RD 1742 CG5028-RD 122..1178 8..1060 4975 98.5 Plus
CG5028-RC 1608 CG5028-RC 122..1178 8..1060 4975 98.5 Plus
CG5028-RB 1934 CG5028-RB 122..1178 8..1060 4975 98.5 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:13:58
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 25681265..25682045 143..922 3840 99.7 Plus
3R 32079331 3R 25681121..25681199 66..144 395 100 Plus
3R 32079331 3R 25682105..25682209 923..1027 375 90.5 Plus
3R 32079331 3R 25680966..25681024 8..66 295 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:13:59 has no hits.

FMO10090.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:55 Download gff for FMO10090.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5028-RC 149..1194 8..1049 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:37 Download gff for FMO10090.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5028-RB 122..1167 8..1049 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:40 Download gff for FMO10090.5prime
Subject Subject Range Query Range Percent Splice Strand
CG5028-RB 122..1167 8..1049 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:40 Download gff for FMO10090.5prime
Subject Subject Range Query Range Percent Splice Strand
3R 25681266..25682045 144..922 99 -> Plus
3R 25681121..25681198 66..143 100 -> Plus
3R 25680966..25681023 8..65 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:37 Download gff for FMO10090.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3R 21506988..21507767 144..922 99 -> Plus
arm_3R 21506843..21506920 66..143 100 -> Plus
arm_3R 21506688..21506745 8..65 100 -> Plus