Clone FMO10092 Report

Search the DGRC for FMO10092

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:92
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG9825-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10092.5prime Sequence

1124 bp (1013 high quality bases) assembled on 2010-10-30

> FMO10092.5prime
CAGTCGACATGACGGCCGAGACAAACAAAGGACCCGTTCTGGGAATGAGG
CATGTCCAGGCGCTACTGATCTTCCTCAATATAACTACCGTATTCATAGG
CCGCCTAAATGTGGGCGTGTCTGTGGTGGCAATGACCAATGCGGAAACCA
CGAACCCGAACTTTCCGGAATACGATTGGACGGAGGCAGAGAAGTCGTAC
ATTCTCTCCAGTTTCTTTTGGGGCTACATCCTAACGCAATTCCTTGGAGG
TTATCTCTGCAAGCGCTTTGGAGTCAAGAGTGTAATGTTTTGGGGTGTCT
TCGGATCTGGTGTCTGCAGTGCTTTGACGCCGCTGTTCATCGGATTTGGA
GAATGGCAGGCCTACTGTGGAATTCGAGTTCTAATGGGATTGGCCCAGGG
AGTGGTATTCCCCTGCATTCATCAGCACCTGGCTAAATGGTCACCGCCCG
AGGAAAGAAATCGGTTGGGAGCTCTGAGTCACACTGGAATCGAGTGCGGC
AATGTGAGTGCCATGTTCCTGAGCGGAATGATAGCCAAGAGCTCCCTGGG
ATGGCCCGGAATCTCATATGTCTCGGCTGGAGTGGCCTTCTTCTGGTGTA
CATTATGGTTCGTCTTCGCTGCCAACCATCCTACGGAATCTCGTTTCATA
GGAGAGAACGAACTGATCTATATTGAGTCGTCTCTAAAGCACAATGAGTC
ATACCACGCTACCATTATACCCATTCCCTGAAGGCAATTTGGACGTCGGC
ACCATTCCTGGCCCTGCTCATAGTACGATGCGCTGAGAACTGGGGACTGA
GCACTCTGCAGGCCGAGATCCCATCCTATATGAACGGAGTCCTCGACATG
GACATGAAGAGCAATGCGTTCTTCTCGGCACTCCCATTCTTGGCCATGTG
GTGCATGTCGTATATTTACCTAGTCGTAGCCGATGTGCTCTTGGGCAAGA
CTCGTGTCCTTGACGATTTTGAAAAAGACTACACTCCATTGCCTCTGGAT
TCTGCTGCCACTTTGGTGTAATGGCTTTTGGAAAAGAACAAGAACTCCCG
ATGCTCTGCATGACCATACGTGTGGCGTGATCTGCTCAACATGGCAGGTT
TACCAATGATCATCGAATTCCGCG

FMO10092.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:14:08
Subject Length Description Subject Range Query Range Score Percent Strand
CG9825-RA 1543 CG9825-RA 76..1162 9..1080 4930 97.8 Plus
CG12490-RB 1647 CG12490-RB 54..967 9..921 2425 84.8 Plus
CG30265-RB 1622 CG30265-RB 58..963 9..913 1370 77.1 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:14:05
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 22837915..22838773 167..1018 3930 99.1 Plus
2R 25286936 2R 22835185..22835940 167..921 1600 81.1 Plus
2R 25286936 2R 22833119..22833866 167..913 1290 78.5 Plus
2R 25286936 2R 22834990..22835129 29..168 700 100 Plus
2R 25286936 2R 22837720..22837859 29..168 700 100 Plus
2R 25286936 2R 22841622..22841790 733..901 275 77.5 Plus
2R 25286936 2R 5962261..5962374 937..824 195 78.1 Minus
Blast to na_te.dros performed on 2014-11-26 15:14:07 has no hits.

FMO10092.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:56 Download gff for FMO10092.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9825-RA 74..1103 9..1029 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:41 Download gff for FMO10092.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9825-RA 76..1105 9..1029 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:45 Download gff for FMO10092.5prime
Subject Subject Range Query Range Percent Splice Strand
CG9825-RA 76..1105 9..1029 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:45 Download gff for FMO10092.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 22837916..22838770 168..1015 99 -> Plus
2R 22837722..22837858 31..167 100 -> Plus
2R 22837436..22837457 9..30 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:41 Download gff for FMO10092.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 18725439..18726293 168..1015 99 -> Plus
arm_2R 18725245..18725381 31..167 100 -> Plus
arm_2R 18724959..18724980 9..30 100 -> Plus