Clone FMO10094 Report

Search the DGRC for FMO10094

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:100
Well:94
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG10616-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10094.5prime Sequence

1135 bp (1042 high quality bases) assembled on 2010-10-30

> FMO10094.5prime
CAGTCGACATGCGCACAGTGCTGTTGAGCAAACACGACGAGCTGTACCTG
GAGAAATGCGCACAGGAGAACCAGTTCTCGTACGGGATAATCGTGGGCCA
TCAAGCGGATCTCACCAAGAGCGTGGTGGTCCACCTGGCCAGGAACAACG
AGGAGGATGCGGATCTGGAGGACCTGTCGGAGGTCCGGCTCACCATCTCG
GACATCAACTCACAGGCATTGGCCTCCCAGTGGCTGAGCGCCAGCAAAAT
GTGTCCCGGATCTTTTGACGTCATCGGAATCTTTGTGTCTTCAGTAAGAT
CCGATGTAGTAAACGAACAGAGCGCCGAATTTAAGAATGCCAAAAAGCTG
TTTTCAGATATTTACGATTTGCTCCTGAAAAGCAACAGCTCGTTTGGCGT
CTACACCACCGACATTGCACAGACTGATTTCGTATTCCTCTCGTATTCGC
TGGCCGACAAGAAAGTGCTCTGCAAGAACTACAGCTATGGCAACGGCGGC
ACTTTCACCAATATGGAGTTCCGGTTTGTGGACAAACCCTTCGAGTGGAT
TCAGCTGGAGTGCAGCTACGATTTCGATGATGTGCTGCCCATACTGGACT
CCTCGCGTCGCGTCAACATCGAAGACCAGTTCCAGAGTATGATAGTGTCG
GTGCGCAAGAACCTGCTCGCCAGTGAAGTATTCCTCCAAAACGAAGTTGT
CGAGGACACCATCGATCTGCAGGCCTATATCAAAAAGAAAAAGACGAAAG
TGGACAAGCTGCAACCGACATCGACAACAGGTGGCACGGCCACTGCCTCG
AGCAACACCACTGACTCCCTGCCGCGGCTTGCGTCCGAAGGATCATCGGA
GGCACTGAAACCATCCGGGCGAGCATCGTGCTCCCCATGAAATGCCAGCT
GAGCAAACCGACGGACATCAAGGTGCGCGAATTTAGTGGCACGCTGCACA
TGAGCGGCATTATTACCTTCAAAGGTATCTGCAATCCTCGAAACAGTATA
GCAGATGTTAGCGTTCTACGCGACGAATGTGCTCGTTCGCTGATACGCGT
ATCAAATGGTACTGCAATGGACTCACGATCAATTGTGACCATGAGCTCTG
TAATTATGGAGCCCCGAACGTGGGTTTCTCGACTG

FMO10094.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:14:12
Subject Length Description Subject Range Query Range Score Percent Strand
CG10616-RC 1838 CG10616-RC 110..1239 9..1126 5135 97.9 Plus
CG10616-RA 1689 CG10616-RA 110..1239 9..1126 5135 97.9 Plus
CG10616-RB 1737 CG10616-RB 643..1287 494..1126 2710 96.3 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 15:14:10
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 12473185..12473772 494..1076 2465 96.9 Plus
3L 28110227 3L 12472022..12472197 102..277 880 100 Plus
3L 28110227 3L 12472707..12472832 368..493 630 100 Plus
3L 28110227 3L 12471837..12471929 9..101 465 100 Plus
3L 28110227 3L 12472546..12472637 276..367 460 100 Plus
Blast to na_te.dros performed on 2014-11-26 15:14:11 has no hits.

FMO10094.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-12 12:04:57 Download gff for FMO10094.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10616-RA 67..1179 1..1102 98   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-03 19:56:44 Download gff for FMO10094.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10616-RA 100..1212 1..1102 98   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 15:52:46 Download gff for FMO10094.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10616-RA 100..1212 1..1102 98   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 15:52:46 Download gff for FMO10094.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 12473185..12473802 494..1102 97   Plus
3L 12472707..12472832 368..493 100 -> Plus
3L 12472547..12472637 277..367 100 -> Plus
3L 12472022..12472196 102..276 100 -> Plus
3L 12471827..12471929 1..101 96 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-03 19:56:44 Download gff for FMO10094.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 12466285..12466902 494..1102 97   Plus
arm_3L 12465807..12465932 368..493 100 -> Plus
arm_3L 12465647..12465737 277..367 100 -> Plus
arm_3L 12465122..12465296 102..276 100 -> Plus
arm_3L 12464927..12465029 1..101 96 -> Plus