Clone FMO10106 Report

Search the DGRC for FMO10106

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:6
Vector:pMK33-CFH-BD
Associated Gene/Transcriptpav-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10106.5prime Sequence

1131 bp (1011 high quality bases) assembled on 2010-11-05

> FMO10106.5prime
CAGTCGACATGAAGGCAGTACCCAGGACGCCGATGCGTGTCGTCCCGAAA
ACTCCGCGGGTGCATCAAACGGTGGAGAAACAGCGACGAGACACCTCCGA
CAAGGCCAGGGATCCAGTGAATGTGTTCTGTCGAGTGCGGCCACTACAAT
CCGACGCAGATCTCACCTCCCTAAGGGTCAAGAACTCCACGACGATCGCA
CTGAATCCGCAGGATCAGCTGCTGCAGCATCACAAGCCACACAACGGCGC
CCAGCGCGAGGTTCAGTACATATTCAAGCACGTTTTCCAGCCGGATGCCA
CGCAGCAGGATGTGTACGCAGCTGTGGCCCAGCCGTTGGTGGAGAACCTA
CTGAAAGGCCGAAACAGTCTGCTTTTCACCTACGGCGTGACTGGAAGTGG
AAAAACGTACACCATGACCGGCAACCTGCGACACCGCGGCATCATGCCGC
GCTGCCTGGACGTGCTCTTTCGCACCATTTCAGATTACCAGGCCAAGAAG
TTCGTCTTCAAGCCGGACAAGCTTAATGGCTTCGAGATCCTGTCCGAAGA
GGATGCGCTTTTGGAGCGCCAACACGAGATGAACCAGCGTTTTGCTGGCT
CAGGACGATTTGCCTTCAGGCACAAGGACTCGGATCCGGAAATTGCATCC
CAGGCCTCCGTGGAGCCAATTCCGCTGCTGGGTTTGGATGAGGACAACAT
GTACTCGGTGTTTGTCACCTATATTGAAATTTACAATAACAGCGTCTACG
ACCTCCTTGAGGACTCGGGTATACAGAAGACTTTGCAGAGCAAATCATTC
GTGAAGATGCCAATCGACACATGTTCGTCCACGGCGTCACAGAGGTGGAG
GTCAAGACCGTGGAGGACGCCCTCGAGGTCTTTCAATGGGCCAGAAGCGC
AAACGAATGGGACACACTGTTCTCAATGCAGAATCCAGTAAGAGTCACTC
GTGTCATATACGCTTGGTGCAGCGCCACTGATAGCCAGGGTGAGAAATGT
GGTCAGGACCGGCAACATCACAGTGAGTCAACTGTCCTTGGTGGATCTTG
CGGCAGTGAGCGATTCCTCAAGGAACAGAAACACGGTGTGCACTCGTGAG
GCGGGCACATTCAATAATTCGCTATGACCTG

FMO10106.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:29
Subject Length Description Subject Range Query Range Score Percent Strand
pav-RA 3207 CG1258-RA 143..1277 7..1128 5135 97.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:27
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 4242948..4243707 20..779 3800 100 Plus
3L 28110227 3L 4243765..4244121 779..1123 945 90.8 Plus
Blast to na_te.dros performed on 2014-11-26 16:51:28 has no hits.

FMO10106.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:37 Download gff for FMO10106.5prime
Subject Subject Range Query Range Percent Splice Strand
pav-RA 135..1279 1..1131 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:27 Download gff for FMO10106.5prime
Subject Subject Range Query Range Percent Splice Strand
pav-RA 137..1281 1..1131 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:38:53 Download gff for FMO10106.5prime
Subject Subject Range Query Range Percent Splice Strand
pav-RA 137..1281 1..1131 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:38:53 Download gff for FMO10106.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 4243765..4244131 779..1131 92   Plus
3L 4242948..4243706 20..778 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:27 Download gff for FMO10106.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 4243765..4244131 779..1131 92   Plus
arm_3L 4242948..4243706 20..778 100 -> Plus