Clone FMO10107 Report

Search the DGRC for FMO10107

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:7
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG10073-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10107.5prime Sequence

1133 bp (723 high quality bases) assembled on 2010-11-05

> FMO10107.5prime
CAGTCGACATGGGTGACAAAGACAAACTGATTTCTGATGAGCCAATCGAA
GATGCCGTTAGATCGGCATCCTCTAAAAAAATCAAAAACCAGGAACAATA
CTTACGAGGACCCTGGTATTTGGCCACTGGTTTTCTACTGTTTTGGGCAC
TCCTCTTCTCGGCCGTGGTATTACCACTCTTTTACCGCATTCCCACAGGA
TTGACCATTGAGGATGCATCCAAGGGCGTCTTTATCGCCGAACGAGCCCA
AATCAATCTTTACTAATTAGCCGAAATCGGTACCAAAGTCGTTGGCAGTG
ATAACAATGAGAACAAAACTGTTGACTATCTGATGGGTCTAGTGAACGAG
ATACAGGAGAATTGCCTGGATGACTACTTCGACATCGAAGTCGATTTGCA
AGAGGTCTCGGGATCCTATATTCATTGGACCATGGTCAATATGTACCATG
GCGTTCAGAATATTGTGATCAAACTGAGTCCCAAGAATACCACGAGTACC
ACTTACCTGCTCGTCAACAGTCACTTCGATTCCAAGCCGACTAGTCCATC
TGCTGGCGATGCTGGTCAGATGGTTGTTGCCATCCTGGAGGTCCTGCGAG
TGATGTGCTCAACCAAGCAAGCCATTAGGCATCCAGTCGTCTTTCTACTG
AACGGAGCCGAGGAGAATCCACTACAAGCTTCGCATGGCTTCATTACCCA
ACACAAATGGGCTTAAAAACTGCAAGGTGGTTCTCAATTTGGATGCAGCT
GGCAATGGCGGGAAGTGATATAGTGTTCCAAACTGGACCTATAGCCCTTG
GCTTGTAGAATAATACAAAGAAGATGCACCACACTATCTGGCTACCAAAT
GGCTGAAGAAATCTTCCAAACAGCATCCTGCCCTCCGACACTGATTTTGC
TATCTTTGTCAGTATGGTAATCTTATGGTTTGACAGGCCAGTTAATCAAT
GGTTCTCCTATCACACCAAGTACGACCATTCCCAATATTCCAGAGGATCC
ATACAAATACGGGGCGAATTATTTGCTTGGTCTGGTGCGAATCCTAGCCC
ATTCCTACGGGAACTGGATAACCAGAGGCTTATGCCACCAGGGAATGCCC
ATCCTTTTCGCAAGTGTCCTTGGGACGTGTACT

FMO10107.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:51:32
Subject Length Description Subject Range Query Range Score Percent Strand
CG10073-RA 2751 CG10073-RA 57..1164 9..1110 4760 96.5 Plus
CG10073-RC 2747 CG10073-RC 73..1160 29..1110 4660 96.4 Plus
CG10081-RB 2732 CG10081-RB 470..794 433..758 300 73.8 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:51:30
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 19381755..19382451 29..726 3395 99.4 Plus
2R 25286936 2R 19382655..19382772 812..926 410 95.8 Plus
2R 25286936 2R 19382511..19382595 726..810 315 96.5 Plus
2R 25286936 2R 19359536..19359653 416..533 230 79.7 Plus
2R 25286936 2R 19377602..19377675 639..712 205 85.1 Plus
2R 25286936 2R 12360234..12360317 629..712 195 82.1 Plus
2R 25286936 2R 12356445..12356532 625..712 185 80.7 Plus
Blast to na_te.dros performed 2014-11-26 16:51:31
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\ninja 6644 Dsim\ninja DSRN 6644bp Derived from D83207 (Rel. 53, Last updated, Version 4). 2935..2998 324..388 115 66.2 Plus

FMO10107.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:12:38 Download gff for FMO10107.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10073-RA 61..1168 9..1110 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:08:29 Download gff for FMO10107.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10073-RA 57..1164 9..1110 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:38:56 Download gff for FMO10107.5prime
Subject Subject Range Query Range Percent Splice Strand
CG10073-RA 57..1164 9..1110 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:38:56 Download gff for FMO10107.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 19382654..19382774 811..927 94 -> Plus
2R 19382511..19382595 726..810 96 -> Plus
2R 19381756..19382450 30..725 99 -> Plus
2R 19381676..19381696 9..29 100 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:08:29 Download gff for FMO10107.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 15270159..15270279 811..927 94 -> Plus
arm_2R 15270016..15270100 726..810 96 -> Plus
arm_2R 15269261..15269955 30..725 99 -> Plus
arm_2R 15269181..15269201 9..29 100 -> Plus