Clone FMO10111 Report

Search the DGRC for FMO10111

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:11
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG32091-RB
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10111.5prime Sequence

1154 bp (1034 high quality bases) assembled on 2010-11-05

> FMO10111.5prime
CAGTCGACATGGAACAGTCGCAGAACTTACTCGCCAAACAGTCCAAAAAT
GTGGAGTTCCAAGATGTGTACTACACCGTCAAGGAGCGCAAGAATTTCTG
GCGCGTAACCGGTGAGCGTCGAATTCTGAATGGAGTCAGCGGCAGTTTCC
GGAATGGTCAACTTTCGGCAATCATGGGACCCTCAGGAGCCGGAAAAAGC
AGTTTGCTTAATGCGATTTCGGGTTTCAGACGCGACGGAGTCACTGGGAA
CATCAAGATGAAGCGGGACAATGCCTGCTATATCACTCAGGACGACCACC
ACCAGACCCTGCTGACTGTCGAGGAGCTTATGAATCTCGCCTGCGATCTC
AAGTTAAAGAATCGTCACAAAAAGGCTGAAATCATGACCGATATATTGGA
GAATCTGCACTTGAATCACCGGCGCAATGTGACGGCAGAGAAGTTGAGTG
GCGGGGAGCGTAAGCGATTGTCCATCGCCCTGGAGCTGGTGGACAATCCA
AACATATTCTTCTTGGACGAACCAACCAGTGGCCTGGACGAAGTGACAGC
GGCCCAGTGCATCCGTTTGCTGCAGGCGATGGCATACGAGGGTCGCACCA
TCGTTTGCACCATCCATCAACCTTCGGCCACGATATACAACTACTTCGAT
AGCATCTACGTCCTGGCCAAGGGCCAATGTGTCTACCAAGGCAGTCCCAG
AGCCACCATTCCCTTTCTGCGATTGGCCCAGCTGGATTGCCCCAGGCATT
ACAGTCCTTCGGATTATATTATTGAGCTGGTGGATGCCGAGGATGGACAC
CTGGTGCCAGCACTCAGCGACCTAACCGAAAACGGGAAGCTGATCTATGT
GGTCAGTCAGTCTGAGCAATTGGCACCTCAGCAGGCGGTCACCACAATGT
TTCTGGAGCAACAGAAGCGTCCATTCTTGCCCGCCTTTTTCGCTGGCAGC
GCCGCCTCCACGGATGGAACGCTAATTGAGGCACCAGTGCTCTGTTGGAG
CAAGTGAATGCCTTCTCGAAGAGACTTCCATTACGATCCGCGGGATGTAT
GTGGGTTTCGGTCAGGTTTATCGTTCTTATGCCGATATGTCTACTGAAAA
TACGCCGTGCCTCGTTTGCAACTTGACATCAATGTTCCATCACCCTGCTT
GGGT

FMO10111.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:55:29
Subject Length Description Subject Range Query Range Score Percent Strand
CG32091-RB 2967 CG32091-RB 680..1821 2..1144 5255 98 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:55:28
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 11640651..11641195 224..768 2725 100 Plus
3L 28110227 3L 11641261..11641592 769..1102 1310 95.5 Plus
3L 28110227 3L 11640068..11640197 100..229 650 100 Plus
3L 28110227 3L 11635094..11635192 2..100 480 99 Plus
Blast to na_te.dros performed on 2014-11-26 16:55:28 has no hits.

FMO10111.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:18 Download gff for FMO10111.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32091-RB 676..1829 1..1154 97   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:42 Download gff for FMO10111.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32091-RB 679..1832 1..1154 97   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:41:01 Download gff for FMO10111.5prime
Subject Subject Range Query Range Percent Splice Strand
CG32091-RB 679..1832 1..1154 97   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:41:01 Download gff for FMO10111.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 11641261..11641587 769..1096 96 -> Plus
3L 11640657..11641195 230..768 100 -> Plus
3L 11640068..11640197 100..229 100 -> Plus
3L 11635093..11635191 1..99 97 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:42 Download gff for FMO10111.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 11634361..11634687 769..1096 96 -> Plus
arm_3L 11633757..11634295 230..768 100 -> Plus
arm_3L 11633168..11633297 100..229 100 -> Plus
arm_3L 11628193..11628291 1..99 97 -> Plus