Clone FMO10112 Report

Search the DGRC for FMO10112

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:101
Well:12
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG8027-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10112.5prime Sequence

1143 bp (1011 high quality bases) assembled on 2010-11-05

> FMO10112.5prime
CAGTCGACATGCGATTACGCCGCCGTTGGCCGCGAAGGATGCGGCGTGCC
ATGGAACAACTGCGTCTCCAGTCCCGCCGGAAGCTGCTGGCGCTCACGAT
GACTGGAGGACTCTGCCTGGCTATCTGGGTAGTTGCCAACTATCTGTCCG
CATCGGAGGAGGGCCAAACCGGCGGCTTCAGCAGCGCCTGCACTGCCATC
GATGCGGTTTACACGTGGGTCAATGGCTCGGATCCCAACTTTATTGAGGA
CATCCGGCGATTCGATGACAAGTACGATCCCTCGCGGTTCGATGACAAGA
ATGAGCTGCGGTACTCTCTGAGGTCCCTGGAAAAACACGCCGCATGGATC
AGGCATGTGTACATAGTAACCAATGGCCAGATTCCAAGTTGGCTGGATCT
CAGCTACGAAAGGGTCACGGTGGTGCCCCACGAAGTCCTGGCTCCCGATC
CCGACCAGCTGCCCACCTTCTCCAGCTCGGCCATCGAGACATTTCTGCAC
CGCATACCAAAGCTGTCCAAGAGGTTCCTCTACCTCAACGACGACATATT
CCTGGGAGCTCCGCTGTATCCGGAGGACTTGTACACTGAAGCGGAGGGAG
TTCGCGTGTACCAGGCATGGATGGTGCCCGGCTGCGCCTTGGATTGCCCC
TGGACGTACATAGGTGATGGAGCTTGCGATCGGCACTGCAACATTGATGC
GTGCCAATTTGATGGAGGCGACTGCAGTGAAACTGGGCCAGCGAGCGATG
CCCACGTCATTCCACCAAGCAAAGAAGTGCTCGAGGTGCAGCCTGCCGCT
GTTCCACAATCAAGAGTCCACCGATTTCCTCAGATGGGTCTCCAAAAGCT
GTTCAGGCGCAGCTCTGCCAATTTTAAAGGATGTTATGCGGCACCGCAAT
GTGTCCACACTCAGGAACTACGTCGCATTGTGAAGCGTTTTACAAGGGCA
AACTCATGTCCTCTGAACCTCCGAACTGGTGACCTCCAGCCTCCGAGCCA
CAGAACAACTCCAGCGCCACGGGCCTGCGCAAGGAGGATTTAAAGTCTTC
CCACCGAAATTTACCTCCTCACCTCGCTGAATGCCACATATGTTGCTGAA
TAAGGCCTTATTGCCTTTAAGGCACGCCCAGGTCTCTTGCGCA

FMO10112.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 16:55:33
Subject Length Description Subject Range Query Range Score Percent Strand
CG8027-RA 2597 CG8027-RA 101..1211 9..1128 5055 97.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 16:55:31
Subject Length Description Subject Range Query Range Score Percent Strand
2R 25286936 2R 9205926..9206872 1051..100 4245 98.5 Minus
2R 25286936 2R 9206934..9207024 99..9 455 100 Minus
Blast to na_te.dros performed on 2014-11-26 16:55:31 has no hits.

FMO10112.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:13:18 Download gff for FMO10112.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8027-RA 92..1220 1..1142 96   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:10:44 Download gff for FMO10112.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8027-RA 95..1223 1..1142 96   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:41:03 Download gff for FMO10112.5prime
Subject Subject Range Query Range Percent Splice Strand
CG8027-RA 95..1223 1..1142 96   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:41:03 Download gff for FMO10112.5prime
Subject Subject Range Query Range Percent Splice Strand
2R 9206934..9207030 1..99 95   Minus
2R 9205841..9206872 100..1142 97 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:10:44 Download gff for FMO10112.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2R 5094439..5094535 1..99 95   Minus
arm_2R 5093346..5094377 100..1142 97 <- Minus